pycom11g01930

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0002872
Physical Location & Seq
Reverse (-)
1687327 .. 1688840
1514 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g01930.1

Sequence Viewer

Length: 288 bp
ATGGCGAGTTGGCCGGCGTGCGAGTTTCCGGCGGACGCCCGTGGCTTCCAAGCTGTTTTCCGGCCAACTCCGACCACGATGACGGAAACCAAGGGGGCGATTATTTGTGGCGTTTCCGTCTTCGCTAGTGGCGTGGCTTTTCGACGGCGAAGTACTGACTTAGAATCGAGGCATACAATCCCGACGTCCAGGCACTTCTGCATCGGCATCTTCGAGTCCTCTTGGTGTAGGACCCACTCCTTTGTTTCATTCAATTTTATATTATTTTCTTTTAGTGTTCTAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.63

Weight (kDa)

8.52

Isoelectric Point (pI)

50.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 188
AciI CCGC 1 cut(s) 32
AcoI YGGCCR 2 cut(s) 11, 62
AcyI GRCGYC 2 cut(s) 36, 185
AfaI GTAC 1 cut(s) 154
AgsI TTSAA 1 cut(s) 253
AjnI CCWGG 1 cut(s) 188
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
AoxI GGCC 2 cut(s) 11, 62
AspS9I GGNCC 1 cut(s) 231
AvaII GGWCC 1 cut(s) 231
BbsI GAAGAC 1 cut(s) 112
BceAI ACGGC 1 cut(s) 161
BciT130I CCWGG 1 cut(s) 190
BfaI CTAG 2 cut(s) 126, 281
BmcAI AGTACT 1 cut(s) 154
Bme1390I CCNGG 1 cut(s) 190
Bme18I GGWCC 1 cut(s) 231
BmgT120I GGNCC 1 cut(s) 231
BmiI GGNNCC 1 cut(s) 233
BmrFI CCNGG 1 cut(s) 190
BmsI GCATC 2 cut(s) 210, 216
BpiI GAAGAC 1 cut(s) 112
BsaHI GRCGYC 2 cut(s) 36, 185
BsaJI CCNNGG 2 cut(s) 40, 90
Bse118I RCCGGY 1 cut(s) 13
BseBI CCWGG 1 cut(s) 190
BseDI CCNNGG 2 cut(s) 40, 90
BshFI GGCC 2 cut(s) 13, 64
BsiSI CCGG 3 cut(s) 14, 29, 61
BsnI GGCC 2 cut(s) 13, 64
BspACI CCGC 1 cut(s) 32
BspANI GGCC 2 cut(s) 13, 64
BspLI GGNNCC 1 cut(s) 233
BsrFI RCCGGY 1 cut(s) 13
BssAI RCCGGY 1 cut(s) 13
BssECI CCNNGG 2 cut(s) 40, 90
BssNI GRCGYC 2 cut(s) 36, 185
BssT1I CCWWGG 1 cut(s) 90
Bst2UI CCWGG 1 cut(s) 190
BstACI GRCGYC 2 cut(s) 36, 185
BstC8I GCNNGC 2 cut(s) 15, 19
BstDEI CTNAG 1 cut(s) 160
BstDSI CCRYGG 1 cut(s) 40
BstNI CCWGG 1 cut(s) 190
BstSCI CCNGG 1 cut(s) 188
BstV2I GAAGAC 1 cut(s) 112
BsuRI GGCC 2 cut(s) 13, 64
BtgI CCRYGG 1 cut(s) 40
Cac8I GCNNGC 2 cut(s) 15, 19
Cfr10I RCCGGY 1 cut(s) 13
Cfr13I GGNCC 1 cut(s) 231
CseI GACGC 1 cut(s) 44
Csp6I GTAC 1 cut(s) 153
CviJI RGCY 5 cut(s) 13, 45, 53, 64, 137
CviKI_1 RGCY 5 cut(s) 13, 45, 53, 64, 137
CviQI GTAC 1 cut(s) 153
DdeI CTNAG 1 cut(s) 160
EaeI YGGCCR 2 cut(s) 11, 62
EciI GGCGGA 1 cut(s) 47
Eco130I CCWWGG 1 cut(s) 90
Eco47I GGWCC 1 cut(s) 231
EcoO109I RGGNCCY 1 cut(s) 231
EcoRII CCWGG 1 cut(s) 188
EcoT14I CCWWGG 1 cut(s) 90
ErhI CCWWGG 1 cut(s) 90
FaiI YATR 2 cut(s) 174, 260
FspBI CTAG 2 cut(s) 126, 281
HaeIII GGCC 2 cut(s) 13, 64
HapII CCGG 3 cut(s) 14, 29, 61
HgaI GACGC 1 cut(s) 44
Hin1I GRCGYC 2 cut(s) 36, 185
HinfI GANTC 2 cut(s) 164, 215
HpaII CCGG 3 cut(s) 14, 29, 61
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 2 cut(s) 181, 281
Hpy99I CGWCG 2 cut(s) 147, 187
HpyCH4IV ACGT 1 cut(s) 185
HpyCH4V TGCA 1 cut(s) 201
HpyF3I CTNAG 1 cut(s) 160
HpySE526I ACGT 1 cut(s) 185
Hsp92I GRCGYC 2 cut(s) 36, 185
KroI GCCGGC 1 cut(s) 13
KroNI GCCGGC 1 cut(s) 15
LpnPI CCDG 5 cut(s) 27, 42, 74, 175, 202
LweI GCATC 2 cut(s) 210, 216
MaeI CTAG 2 cut(s) 126, 281
MaeII ACGT 1 cut(s) 185
MboII GAAGA 2 cut(s) 112, 202
MluCI AATT 1 cut(s) 253
MlyI GAGTC 1 cut(s) 224
MmeI TCCRAC 1 cut(s) 95
MnlI CCTC 2 cut(s) 162, 229
MroNI GCCGGC 1 cut(s) 13
MspI CCGG 3 cut(s) 14, 29, 61
MspR9I CCNGG 1 cut(s) 190
MvaI CCWGG 1 cut(s) 190
NaeI GCCGGC 1 cut(s) 15
NgoMIV GCCGGC 1 cut(s) 13
NlaIV GGNNCC 1 cut(s) 233
PcsI WCGNNNNNNNCGW 2 cut(s) 129, 210
PdiI GCCGGC 1 cut(s) 15
PfeI GAWTC 1 cut(s) 164
PleI GAGTC 1 cut(s) 223
PpsI GAGTC 1 cut(s) 223
PpuMI RGGWCCY 1 cut(s) 231
Psp5II RGGWCCY 1 cut(s) 231
Psp6I CCWGG 1 cut(s) 188
PspGI CCWGG 1 cut(s) 188
PspN4I GGNNCC 1 cut(s) 233
PspPI GGNCC 1 cut(s) 231
PspPPI RGGWCCY 1 cut(s) 231
RsaI GTAC 1 cut(s) 154
RsaNI GTAC 1 cut(s) 153
Sau96I GGNCC 1 cut(s) 231
ScaI AGTACT 1 cut(s) 154
SchI GAGTC 1 cut(s) 224
ScrFI CCNGG 1 cut(s) 190
SetI ASST 2 cut(s) 55, 188
SfaNI GCATC 2 cut(s) 210, 216
SinI GGWCC 1 cut(s) 231
Sse9I AATT 1 cut(s) 253
SsiI CCGC 1 cut(s) 32
SspMI CTAG 2 cut(s) 126, 281
StyD4I CCNGG 1 cut(s) 188
StyI CCWWGG 1 cut(s) 90
TaiI ACGT 1 cut(s) 188
TaqI TCGA 3 cut(s) 142, 167, 213
TasI AATT 1 cut(s) 253
TatI WGTACW 1 cut(s) 152
TfiI GAWTC 1 cut(s) 164
TspDTI ATGAA 1 cut(s) 237
TspGWI ACGGA 2 cut(s) 98, 106
VpaK11BI GGWCC 1 cut(s) 231
XbaI TCTAGA 1 cut(s) 280
XspI CTAG 2 cut(s) 126, 281
ZraI GACGTC 1 cut(s) 186
ZrmI AGTACT 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.