pycom09g07290

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
OG0002872
Physical Location & Seq
Reverse (-)
5481189 .. 5482865
1677 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g07290.4

Sequence Viewer

Length: 321 bp
ATGAAGAAACCACCTCGAAATTTCCGGCAAAACCACTGCGAGTTGGCCGGTGTGCAAGTTCCGGAGGACATCCGTGGCTTCCAGGCTGTTTTCCAGCCAACTCCGACCACGATGACGGGAACCAAGGGGGCGTTTAATTGTGGCGTTTCCGTCTTCGCTAGTGGCGTGGCTTTTCGACGGCGAAGTACTGACTTAGAATCGAGGCATACAATCCTGACGTCCAGGCACTTCCGCATCGGCATCTTCGAGTCCTCGTGGTGTAGGACCCACTCCTTTGTCTCATTTAATTTTATATTATTTTCTTTTAGTGTTCTAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

12.05

Weight (kDa)

10.28

Isoelectric Point (pI)

41.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 221
AccIII TCCGGA 1 cut(s) 61
AciI CCGC 1 cut(s) 232
AcoI YGGCCR 1 cut(s) 45
AcsI RAATTY 1 cut(s) 19
AcyI GRCGYC 1 cut(s) 218
AfaI GTAC 1 cut(s) 187
AjnI CCWGG 2 cut(s) 81, 221
Alw26I GTCTC 1 cut(s) 283
Aor13HI TCCGGA 1 cut(s) 61
AoxI GGCC 1 cut(s) 45
ApoI RAATTY 1 cut(s) 19
AspS9I GGNCC 1 cut(s) 264
AvaII GGWCC 1 cut(s) 264
BauI CACGAG 1 cut(s) 253
BbsI GAAGAC 1 cut(s) 145
BceAI ACGGC 1 cut(s) 194
BciT130I CCWGG 2 cut(s) 83, 223
BcoDI GTCTC 1 cut(s) 283
BfaI CTAG 2 cut(s) 159, 314
BmcAI AGTACT 1 cut(s) 187
Bme1390I CCNGG 2 cut(s) 83, 223
Bme18I GGWCC 1 cut(s) 264
BmgT120I GGNCC 1 cut(s) 264
BmiI GGNNCC 2 cut(s) 121, 266
BmrFI CCNGG 2 cut(s) 83, 223
BmsI GCATC 2 cut(s) 243, 249
BpiI GAAGAC 1 cut(s) 145
BsaHI GRCGYC 1 cut(s) 218
BsaJI CCNNGG 2 cut(s) 73, 123
BsaWI WCCGGW 1 cut(s) 61
Bse118I RCCGGY 1 cut(s) 47
BseAI TCCGGA 1 cut(s) 61
BseBI CCWGG 2 cut(s) 83, 223
BseDI CCNNGG 2 cut(s) 73, 123
BseGI GGATG 1 cut(s) 69
BshFI GGCC 1 cut(s) 47
BsiSI CCGG 3 cut(s) 25, 48, 62
BsmAI GTCTC 1 cut(s) 283
BsnI GGCC 1 cut(s) 47
Bsp13I TCCGGA 1 cut(s) 61
BspACI CCGC 1 cut(s) 232
BspANI GGCC 1 cut(s) 47
BspEI TCCGGA 1 cut(s) 61
BspLI GGNNCC 2 cut(s) 121, 266
BsrFI RCCGGY 1 cut(s) 47
BssAI RCCGGY 1 cut(s) 47
BssECI CCNNGG 2 cut(s) 73, 123
BssNI GRCGYC 1 cut(s) 218
BssSI CACGAG 1 cut(s) 253
BssT1I CCWWGG 1 cut(s) 123
Bst2BI CACGAG 1 cut(s) 253
Bst2UI CCWGG 2 cut(s) 83, 223
BstACI GRCGYC 1 cut(s) 218
BstDEI CTNAG 1 cut(s) 193
BstDSI CCRYGG 1 cut(s) 73
BstF5I GGATG 1 cut(s) 69
BstMAI GTCTC 1 cut(s) 283
BstNI CCWGG 2 cut(s) 83, 223
BstSCI CCNGG 2 cut(s) 81, 221
BstV2I GAAGAC 1 cut(s) 145
BsuRI GGCC 1 cut(s) 47
BtgI CCRYGG 1 cut(s) 73
BtsCI GGATG 1 cut(s) 69
BtsI GCAGTG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 34
Cfr10I RCCGGY 1 cut(s) 47
Cfr13I GGNCC 1 cut(s) 264
Csp6I GTAC 1 cut(s) 186
CviJI RGCY 5 cut(s) 47, 78, 86, 97, 170
CviKI_1 RGCY 5 cut(s) 47, 78, 86, 97, 170
CviQI GTAC 1 cut(s) 186
DdeI CTNAG 1 cut(s) 193
EaeI YGGCCR 1 cut(s) 45
Eco130I CCWWGG 1 cut(s) 123
Eco47I GGWCC 1 cut(s) 264
EcoO109I RGGNCCY 1 cut(s) 264
EcoRII CCWGG 2 cut(s) 81, 221
EcoT14I CCWWGG 1 cut(s) 123
ErhI CCWWGG 1 cut(s) 123
FaiI YATR 2 cut(s) 207, 293
FokI GGATG 1 cut(s) 56
FspBI CTAG 2 cut(s) 159, 314
HaeIII GGCC 1 cut(s) 47
HapII CCGG 3 cut(s) 25, 48, 62
Hin1I GRCGYC 1 cut(s) 218
HinfI GANTC 2 cut(s) 197, 248
HpaII CCGG 3 cut(s) 25, 48, 62
Hpy188I TCNGA 1 cut(s) 105
Hpy188III TCNNGA 3 cut(s) 62, 214, 314
Hpy99I CGWCG 1 cut(s) 180
HpyCH4IV ACGT 1 cut(s) 218
HpyCH4V TGCA 1 cut(s) 55
HpyF3I CTNAG 1 cut(s) 193
HpySE526I ACGT 1 cut(s) 218
Hsp92I GRCGYC 1 cut(s) 218
Kpn2I TCCGGA 1 cut(s) 61
LpnPI CCDG 9 cut(s) 38, 61, 68, 75, 95, 107, 208, 227, 235
LweI GCATC 2 cut(s) 243, 249
MaeI CTAG 2 cut(s) 159, 314
MaeII ACGT 1 cut(s) 218
MboII GAAGA 3 cut(s) 16, 145, 235
MluCI AATT 3 cut(s) 19, 136, 286
MlyI GAGTC 1 cut(s) 257
MmeI TCCRAC 1 cut(s) 128
MnlI CCTC 4 cut(s) 24, 58, 195, 262
MroI TCCGGA 1 cut(s) 61
MseI TTAA 2 cut(s) 135, 285
MspI CCGG 3 cut(s) 25, 48, 62
MspR9I CCNGG 2 cut(s) 83, 223
MvaI CCWGG 2 cut(s) 83, 223
NlaIV GGNNCC 2 cut(s) 121, 266
PcsI WCGNNNNNNNCGW 2 cut(s) 162, 243
PfeI GAWTC 1 cut(s) 197
PleI GAGTC 1 cut(s) 256
PpsI GAGTC 1 cut(s) 256
PpuMI RGGWCCY 1 cut(s) 264
Psp5II RGGWCCY 1 cut(s) 264
Psp6I CCWGG 2 cut(s) 81, 221
PspGI CCWGG 2 cut(s) 81, 221
PspN4I GGNNCC 2 cut(s) 121, 266
PspPI GGNCC 1 cut(s) 264
PspPPI RGGWCCY 1 cut(s) 264
RsaI GTAC 1 cut(s) 187
RsaNI GTAC 1 cut(s) 186
SaqAI TTAA 2 cut(s) 135, 285
Sau96I GGNCC 1 cut(s) 264
ScaI AGTACT 1 cut(s) 187
SchI GAGTC 1 cut(s) 257
ScrFI CCNGG 2 cut(s) 83, 223
SetI ASST 2 cut(s) 16, 221
SfaNI GCATC 2 cut(s) 243, 249
SinI GGWCC 1 cut(s) 264
Sse9I AATT 3 cut(s) 19, 136, 286
SsiI CCGC 1 cut(s) 232
SspMI CTAG 2 cut(s) 159, 314
StyD4I CCNGG 2 cut(s) 81, 221
StyI CCWWGG 1 cut(s) 123
TaiI ACGT 1 cut(s) 221
TaqI TCGA 4 cut(s) 16, 175, 200, 246
TasI AATT 3 cut(s) 19, 136, 286
TatI WGTACW 1 cut(s) 185
TfiI GAWTC 1 cut(s) 197
Tru1I TTAA 2 cut(s) 135, 285
Tru9I TTAA 2 cut(s) 135, 285
TscAI CASTG 1 cut(s) 41
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 62, 139
TspRI CASTG 1 cut(s) 41
VpaK11BI GGWCC 1 cut(s) 264
XapI RAATTY 1 cut(s) 19
XbaI TCTAGA 1 cut(s) 313
XspI CTAG 2 cut(s) 159, 314
ZraI GACGTC 1 cut(s) 219
ZrmI AGTACT 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.