pycom04g09260

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0002872
Physical Location & Seq
Forward (+)
11744038 .. 11745648
1611 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g09260.1

Sequence Viewer

Length: 270 bp
ATGCGAGTTCCGGCGGACACCCGTGGCTTCCAGGCTGTTTTCCAGCCAACTCCGACCACGATGACGGGAACCAAGGGGGCGTTTATTTGTGGCGTTTCCGTCTTCGCTAGTGGCGTGGCTTTTCGACGGCGAAGTACTGACTTAGAATCGAGGCATACAATCCCGACGTCCAGGCACTTCCGCATCGGCATCTTCGAGTCCTCTCGGTGTAGGACCCACTCCTTTGTTTCATTCAATTTTATTATTATTTTCTTTAGTGTTCTAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.01

Weight (kDa)

11.41

Isoelectric Point (pI)

37.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 170
AciI CCGC 2 cut(s) 14, 181
AcyI GRCGYC 1 cut(s) 167
AfaI GTAC 1 cut(s) 136
AgsI TTSAA 1 cut(s) 235
AjnI CCWGG 2 cut(s) 30, 170
AspS9I GGNCC 1 cut(s) 213
AvaII GGWCC 1 cut(s) 213
BbsI GAAGAC 1 cut(s) 94
BceAI ACGGC 1 cut(s) 143
BciT130I CCWGG 2 cut(s) 32, 172
BfaI CTAG 2 cut(s) 108, 263
BmcAI AGTACT 1 cut(s) 136
Bme1390I CCNGG 2 cut(s) 32, 172
Bme18I GGWCC 1 cut(s) 213
BmgT120I GGNCC 1 cut(s) 213
BmiI GGNNCC 2 cut(s) 70, 215
BmrFI CCNGG 2 cut(s) 32, 172
BmsI GCATC 2 cut(s) 192, 198
BpiI GAAGAC 1 cut(s) 94
BsaHI GRCGYC 1 cut(s) 167
BsaJI CCNNGG 2 cut(s) 22, 72
BseBI CCWGG 2 cut(s) 32, 172
BseDI CCNNGG 2 cut(s) 22, 72
BsiSI CCGG 1 cut(s) 11
BspACI CCGC 2 cut(s) 14, 181
BspLI GGNNCC 2 cut(s) 70, 215
BssECI CCNNGG 2 cut(s) 22, 72
BssNI GRCGYC 1 cut(s) 167
BssT1I CCWWGG 1 cut(s) 72
Bst2UI CCWGG 2 cut(s) 32, 172
BstACI GRCGYC 1 cut(s) 167
BstDEI CTNAG 1 cut(s) 142
BstDSI CCRYGG 1 cut(s) 22
BstNI CCWGG 2 cut(s) 32, 172
BstSCI CCNGG 2 cut(s) 30, 170
BstV2I GAAGAC 1 cut(s) 94
BtgI CCRYGG 1 cut(s) 22
Cfr13I GGNCC 1 cut(s) 213
Csp6I GTAC 1 cut(s) 135
CviJI RGCY 4 cut(s) 27, 35, 46, 119
CviKI_1 RGCY 4 cut(s) 27, 35, 46, 119
CviQI GTAC 1 cut(s) 135
DdeI CTNAG 1 cut(s) 142
EciI GGCGGA 1 cut(s) 29
Eco130I CCWWGG 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 213
EcoO109I RGGNCCY 1 cut(s) 213
EcoRII CCWGG 2 cut(s) 30, 170
EcoT14I CCWWGG 1 cut(s) 72
ErhI CCWWGG 1 cut(s) 72
FaiI YATR 1 cut(s) 156
FspBI CTAG 2 cut(s) 108, 263
HapII CCGG 1 cut(s) 11
Hin1I GRCGYC 1 cut(s) 167
HinfI GANTC 2 cut(s) 146, 197
HpaII CCGG 1 cut(s) 11
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 2 cut(s) 163, 263
Hpy99I CGWCG 2 cut(s) 129, 169
HpyCH4IV ACGT 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 142
HpySE526I ACGT 1 cut(s) 167
Hsp92I GRCGYC 1 cut(s) 167
LpnPI CCDG 6 cut(s) 17, 24, 44, 56, 157, 184
LweI GCATC 2 cut(s) 192, 198
MaeI CTAG 2 cut(s) 108, 263
MaeII ACGT 1 cut(s) 167
MboII GAAGA 2 cut(s) 94, 184
MluCI AATT 1 cut(s) 235
MlyI GAGTC 1 cut(s) 206
MmeI TCCRAC 1 cut(s) 77
MnlI CCTC 2 cut(s) 144, 211
MspI CCGG 1 cut(s) 11
MspR9I CCNGG 2 cut(s) 32, 172
MvaI CCWGG 2 cut(s) 32, 172
NlaIV GGNNCC 2 cut(s) 70, 215
PcsI WCGNNNNNNNCGW 2 cut(s) 111, 192
PfeI GAWTC 1 cut(s) 146
PleI GAGTC 1 cut(s) 205
PpsI GAGTC 1 cut(s) 205
PpuMI RGGWCCY 1 cut(s) 213
Psp5II RGGWCCY 1 cut(s) 213
Psp6I CCWGG 2 cut(s) 30, 170
PspGI CCWGG 2 cut(s) 30, 170
PspN4I GGNNCC 2 cut(s) 70, 215
PspPI GGNCC 1 cut(s) 213
PspPPI RGGWCCY 1 cut(s) 213
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
Sau96I GGNCC 1 cut(s) 213
ScaI AGTACT 1 cut(s) 136
SchI GAGTC 1 cut(s) 206
ScrFI CCNGG 2 cut(s) 32, 172
SetI ASST 1 cut(s) 170
SfaNI GCATC 2 cut(s) 192, 198
SinI GGWCC 1 cut(s) 213
Sse9I AATT 1 cut(s) 235
SsiI CCGC 2 cut(s) 14, 181
SspMI CTAG 2 cut(s) 108, 263
StyD4I CCNGG 2 cut(s) 30, 170
StyI CCWWGG 1 cut(s) 72
TaiI ACGT 1 cut(s) 170
TaqI TCGA 3 cut(s) 124, 149, 195
TasI AATT 1 cut(s) 235
TatI WGTACW 1 cut(s) 134
TfiI GAWTC 1 cut(s) 146
TspDTI ATGAA 1 cut(s) 219
TspGWI ACGGA 1 cut(s) 88
VpaK11BI GGWCC 1 cut(s) 213
XbaI TCTAGA 1 cut(s) 262
XspI CTAG 2 cut(s) 108, 263
ZraI GACGTC 1 cut(s) 168
ZrmI AGTACT 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.