pycom09g03060

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
OG0002872
Physical Location & Seq
Forward (+)
2278028 .. 2279513
1486 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g03060.4

Sequence Viewer

Length: 216 bp
ATGACGGGAACCAAGGGGGCGTTTAATTGTGGCGTTTCCTTCTTCGCTAGATGGCGTGGCTTTTCGACGGCGAAGTACTATCCGGACTTAGAATCGAGGCATACAATCCCGACGTCCAGGCATTTCCGCATCGGCATCTTCGAGTCCTCTCGGTGTAGGACCCACTCCTTTGTTTCATTCAATTTTATATTATTTTCTTCTAATGTTCTAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.19

Weight (kDa)

10.04

Isoelectric Point (pI)

34.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 116
AccIII TCCGGA 1 cut(s) 82
AciI CCGC 1 cut(s) 127
AcyI GRCGYC 1 cut(s) 113
AfaI GTAC 1 cut(s) 77
AgsI TTSAA 1 cut(s) 181
AjnI CCWGG 1 cut(s) 116
Aor13HI TCCGGA 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 159
AvaII GGWCC 1 cut(s) 159
BccI CCATC 1 cut(s) 45
BceAI ACGGC 1 cut(s) 84
BciT130I CCWGG 1 cut(s) 118
BfaI CTAG 2 cut(s) 48, 209
BmcAI AGTACT 1 cut(s) 77
Bme1390I CCNGG 1 cut(s) 118
Bme18I GGWCC 1 cut(s) 159
BmgT120I GGNCC 1 cut(s) 159
BmiI GGNNCC 2 cut(s) 10, 161
BmrFI CCNGG 1 cut(s) 118
BmsI GCATC 2 cut(s) 138, 144
BsaHI GRCGYC 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 12
BsaWI WCCGGW 1 cut(s) 82
BseAI TCCGGA 1 cut(s) 82
BseBI CCWGG 1 cut(s) 118
BseDI CCNNGG 1 cut(s) 12
BsiSI CCGG 1 cut(s) 83
Bsp13I TCCGGA 1 cut(s) 82
BspACI CCGC 1 cut(s) 127
BspEI TCCGGA 1 cut(s) 82
BspLI GGNNCC 2 cut(s) 10, 161
BssECI CCNNGG 1 cut(s) 12
BssNI GRCGYC 1 cut(s) 113
BssT1I CCWWGG 1 cut(s) 12
Bst2UI CCWGG 1 cut(s) 118
BstACI GRCGYC 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 88
BstNI CCWGG 1 cut(s) 118
BstSCI CCNGG 1 cut(s) 116
Cfr13I GGNCC 1 cut(s) 159
Csp6I GTAC 1 cut(s) 76
CviJI RGCY 1 cut(s) 60
CviKI_1 RGCY 1 cut(s) 60
CviQI GTAC 1 cut(s) 76
DdeI CTNAG 1 cut(s) 88
Eco130I CCWWGG 1 cut(s) 12
Eco47I GGWCC 1 cut(s) 159
EcoO109I RGGNCCY 1 cut(s) 159
EcoRII CCWGG 1 cut(s) 116
EcoT14I CCWWGG 1 cut(s) 12
ErhI CCWWGG 1 cut(s) 12
FaiI YATR 2 cut(s) 102, 188
FspBI CTAG 2 cut(s) 48, 209
HapII CCGG 1 cut(s) 83
Hin1I GRCGYC 1 cut(s) 113
HinfI GANTC 2 cut(s) 92, 143
HpaII CCGG 1 cut(s) 83
Hpy188III TCNNGA 3 cut(s) 83, 109, 209
Hpy99I CGWCG 2 cut(s) 70, 115
HpyAV CCTTC 1 cut(s) 49
HpyCH4IV ACGT 1 cut(s) 113
HpyF3I CTNAG 1 cut(s) 88
HpySE526I ACGT 1 cut(s) 113
Hsp92I GRCGYC 1 cut(s) 113
Kpn2I TCCGGA 1 cut(s) 82
LpnPI CCDG 3 cut(s) 96, 103, 130
LweI GCATC 2 cut(s) 138, 144
MaeI CTAG 2 cut(s) 48, 209
MaeII ACGT 1 cut(s) 113
MboII GAAGA 3 cut(s) 34, 130, 189
MluCI AATT 2 cut(s) 25, 181
MlyI GAGTC 1 cut(s) 152
MnlI CCTC 2 cut(s) 90, 157
MroI TCCGGA 1 cut(s) 82
MseI TTAA 1 cut(s) 24
MspI CCGG 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 118
MvaI CCWGG 1 cut(s) 118
NlaIV GGNNCC 2 cut(s) 10, 161
PcsI WCGNNNNNNNCGW 1 cut(s) 138
PfeI GAWTC 1 cut(s) 92
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
PpuMI RGGWCCY 1 cut(s) 159
Psp5II RGGWCCY 1 cut(s) 159
Psp6I CCWGG 1 cut(s) 116
PspGI CCWGG 1 cut(s) 116
PspN4I GGNNCC 2 cut(s) 10, 161
PspPI GGNCC 1 cut(s) 159
PspPPI RGGWCCY 1 cut(s) 159
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
SaqAI TTAA 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 159
ScaI AGTACT 1 cut(s) 77
SchI GAGTC 1 cut(s) 152
ScrFI CCNGG 1 cut(s) 118
SetI ASST 1 cut(s) 116
SfaNI GCATC 2 cut(s) 138, 144
SinI GGWCC 1 cut(s) 159
Sse9I AATT 2 cut(s) 25, 181
SsiI CCGC 1 cut(s) 127
SspMI CTAG 2 cut(s) 48, 209
StyD4I CCNGG 1 cut(s) 116
StyI CCWWGG 1 cut(s) 12
TaiI ACGT 1 cut(s) 116
TaqI TCGA 3 cut(s) 65, 95, 141
TasI AATT 2 cut(s) 25, 181
TatI WGTACW 1 cut(s) 75
TfiI GAWTC 1 cut(s) 92
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TspDTI ATGAA 1 cut(s) 165
VpaK11BI GGWCC 1 cut(s) 159
XbaI TCTAGA 1 cut(s) 208
XspI CTAG 2 cut(s) 48, 209
ZraI GACGTC 1 cut(s) 114
ZrmI AGTACT 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.