MD02G1269000.v1.1

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Forward (+)
32358837 .. 32361410
2574 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1269000.v1.1.491

Sequence Viewer

Length: 285 bp
ATGATTGCTGGTTTCCATGTGGCTTTTCAATCATCTGGGTTTGATATGGTATACTGGAAATCGCAAAACCTTGATTTTGTTTATCAGCTTGTGGCGGTAACCATAAAGCTCTCTGATGCGTCAAATGAAATTGAGCTTGCAAGATATGTTGTTGAGTATGCCCAGAATTTGAAGAAAATGACCATTCTTTGTTCAAGTTTCCAACAACCAAGTGATGTCCAAGGGAAGGTAAGCAAATGCAAGATGTTTTCGACGGCTTTTGTTGTCATTCAGTCAAGTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.57

Weight (kDa)

7.75

Isoelectric Point (pI)

43.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 51
AciI CCGC 1 cut(s) 95
AcsI RAATTY 1 cut(s) 166
AfiI CCNNNNNNNGG 1 cut(s) 226
AgsI TTSAA 3 cut(s) 29, 172, 195
AluBI AGCT 3 cut(s) 88, 109, 136
AluI AGCT 3 cut(s) 88, 109, 136
ApoI RAATTY 1 cut(s) 166
BceAI ACGGC 1 cut(s) 270
BmsI GCATC 1 cut(s) 106
BsaJI CCNNGG 1 cut(s) 220
Bsc4I CCNNNNNNNGG 1 cut(s) 226
Bse1I ACTGG 1 cut(s) 59
BseDI CCNNGG 1 cut(s) 220
BseLI CCNNNNNNNGG 1 cut(s) 226
BseNI ACTGG 1 cut(s) 59
BslI CCNNNNNNNGG 1 cut(s) 226
BspACI CCGC 1 cut(s) 95
BsrI ACTGG 1 cut(s) 59
BssECI CCNNGG 1 cut(s) 220
BssNAI GTATAC 1 cut(s) 52
BssT1I CCWWGG 1 cut(s) 220
Bst1107I GTATAC 1 cut(s) 52
BstC8I GCNNGC 1 cut(s) 138
BstEII GGTNACC 1 cut(s) 97
BstPI GGTNACC 1 cut(s) 97
BstZ17I GTATAC 1 cut(s) 52
Cac8I GCNNGC 1 cut(s) 138
CseI GACGC 1 cut(s) 108
CviAII CATG 1 cut(s) 17
CviJI RGCY 5 cut(s) 23, 88, 109, 136, 257
CviKI_1 RGCY 5 cut(s) 23, 88, 109, 136, 257
Eco130I CCWWGG 1 cut(s) 220
Eco91I GGTNACC 1 cut(s) 97
EcoO65I GGTNACC 1 cut(s) 97
EcoT14I CCWWGG 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 220
FaeI CATG 1 cut(s) 20
FaiI YATR 6 cut(s) 18, 47, 52, 104, 147, 159
FatI CATG 1 cut(s) 16
FblI GTMKAC 1 cut(s) 51
HgaI GACGC 1 cut(s) 108
Hin1II CATG 1 cut(s) 20
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 115
Hpy8I GTNNAC 1 cut(s) 52
Hpy99I CGWCG 1 cut(s) 256
HpyAV CCTTC 1 cut(s) 220
HpyCH4V TGCA 2 cut(s) 140, 240
Hsp92II CATG 1 cut(s) 20
LpnPI CCDG 3 cut(s) 21, 40, 176
LweI GCATC 1 cut(s) 106
MaeIII GTNAC 1 cut(s) 97
MboII GAAGA 1 cut(s) 184
MluCI AATT 2 cut(s) 129, 166
MmeI TCCRAC 1 cut(s) 226
NlaIII CATG 1 cut(s) 20
PspEI GGTNACC 1 cut(s) 97
SetI ASST 5 cut(s) 72, 90, 111, 138, 231
SfaNI GCATC 1 cut(s) 106
Sse9I AATT 2 cut(s) 129, 166
SsiI CCGC 1 cut(s) 95
StyI CCWWGG 1 cut(s) 220
TaqI TCGA 1 cut(s) 251
TasI AATT 2 cut(s) 129, 166
TspDTI ATGAA 1 cut(s) 141
XapI RAATTY 1 cut(s) 166
XmiI GTMKAC 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.