Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000004

Orthogroup ID

OG0004213

Physical Location & Seq

Genomic Coordinates Reverse (-)

48955968 .. 48956855

Gene Structure 888 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_4G00320320.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 336 bp

ATGGACCTGGTCGACCTTAATATCTCCTGTCAGAAACTTAGAAGTATTAAAATAAAGTGGAACTTTTATGCTTCACCTGGGTACCGCTCATCGAATATATCTGCTCCAAATCTGGAAGATTTAACATGGGTGGGCAAGGTCTTGAATAGCCAAAACCTGGGCAAATTACTGAATTTAAAAAGAGCTTTCATTGCTCTTGAGCCTACGGTAGATGACAATTTATCTGAGGTCTTTTCTATTATATGTAGGACTACAGATCTTGGTATAAATGAGAACACCATGAAGCGAGCAGATTGGGTTGATCAATTAAGGAAGGATACAATTGCCCTTCACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box

Protein Analysis

111

Amino Acids

12.64

Weight (kDa)

7.76

Isoelectric Point (pI)

36.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004213)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g16170 FvH4_6g18953 FvH4_7g04740 FvH4_7g04740
malus_domestica	MD02G1269000.v1.1 MD04G1145300.v1.1 MD04G1145500.v1.1 MD04G1145600.v1.1 MD04G1145900.v1.1 MD12G1159100.v1.1
prunus_persica	Prupe.2G052100_v2.0.a1 Prupe.7G105700_v2.0.a1 Prupe.7G106400_v2.0.a1
pyrus_communis	pycom04g13150
rosa_chinensis	RchiOBHm_Chr1g0330111
rosa_laevigata	RLG00000029830
rosa_multiflora	Rmu_sc0004673.1_g000009
rosa_roxburghii	Rroxscaffold_4G00320200 Rroxscaffold_4G00320300 Rroxscaffold_4G00320320 Rroxscaffold_4G00320330
rosa_rugosa	Rorug01G0086000 Rorug01G0086100 Rorug01G0086200 Rorug02G0131100 Rorug03G0137300
rosa_samantha	Rh1AG104600 Rh1AG104700 Rh1BG082800 Rh1CG100200 Rh1DG107500 Rh1DG108500
rosa_wichuraiana	Rw0G015890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	81
AccB1I	GGYRCC	1 cut(s)	81
AccB7I	CCANNNNNTGG	1 cut(s)	157
AccBSI	CCGCTC	1 cut(s)	87
AccI	GTMKAC	1 cut(s)	12
AciI	CCGC	1 cut(s)	85
AcsI	RAATTY	1 cut(s)	172
AfaI	GTAC	1 cut(s)	83
AfiI	CCNNNNNNNGG	1 cut(s)	157
AgsI	TTSAA	1 cut(s)	145
AjnI	CCWGG	3 cut(s)	6, 76, 156
AluBI	AGCT	1 cut(s)	185
AluI	AGCT	1 cut(s)	185
ApoI	RAATTY	1 cut(s)	172
Asp718I	GGTACC	1 cut(s)	81
AspS9I	GGNCC	1 cut(s)	4
AsuHPI	GGTGA	1 cut(s)	66
AvaII	GGWCC	1 cut(s)	4
BaeI	ACNNNNGTAYC	2 cut(s)	65, 98
BanI	GGYRCC	1 cut(s)	81
BciT130I	CCWGG	3 cut(s)	8, 78, 158
BciVI	GTATCC	1 cut(s)	310
BclI	TGATCA	1 cut(s)	301
BfaI	CTAG	1 cut(s)	334
BfmI	CTRYAG	1 cut(s)	252
BfuI	GTATCC	1 cut(s)	310
BglII	AGATCT	1 cut(s)	256
Bme1390I	CCNGG	3 cut(s)	8, 78, 158
Bme18I	GGWCC	1 cut(s)	4
BmgT120I	GGNCC	1 cut(s)	4
BmiI	GGNNCC	1 cut(s)	83
BmrFI	CCNGG	3 cut(s)	8, 78, 158
BpuEI	CTTGAG	1 cut(s)	218
BsaJI	CCNNGG	2 cut(s)	77, 157
Bsc4I	CCNNNNNNNGG	1 cut(s)	157
Bse3DI	GCAATG	1 cut(s)	189
BseBI	CCWGG	3 cut(s)	8, 78, 158
BseDI	CCNNGG	2 cut(s)	77, 157
BseLI	CCNNNNNNNGG	1 cut(s)	157
BseMI	GCAATG	1 cut(s)	189
BseMII	CTCAG	1 cut(s)	216
BshNI	GGYRCC	1 cut(s)	81
BslI	CCNNNNNNNGG	1 cut(s)	157
Bsp143I	GATC	2 cut(s)	256, 301
BspACI	CCGC	1 cut(s)	85
BspCNI	CTCAG	1 cut(s)	217
BspLI	GGNNCC	1 cut(s)	83
BspT107I	GGYRCC	1 cut(s)	81
BsrBI	CCGCTC	1 cut(s)	87
BsrDI	GCAATG	1 cut(s)	189
BssECI	CCNNGG	2 cut(s)	77, 157
BssMI	GATC	2 cut(s)	256, 301
Bst2UI	CCWGG	3 cut(s)	8, 78, 158
Bst4CI	ACNGT	1 cut(s)	208
BstC8I	GCNNGC	1 cut(s)	288
BstDEI	CTNAG	2 cut(s)	38, 225
BstKTI	GATC	2 cut(s)	259, 304
BstMBI	GATC	2 cut(s)	256, 301
BstMWI	GCNNNNNNNGC	1 cut(s)	191
BstNI	CCWGG	3 cut(s)	8, 78, 158
BstSCI	CCNGG	3 cut(s)	6, 76, 156
BstSFI	CTRYAG	1 cut(s)	252
BstX2I	RGATCY	1 cut(s)	256
BstYI	RGATCY	1 cut(s)	256
BsuI	GTATCC	1 cut(s)	310
Cac8I	GCNNGC	1 cut(s)	288
Cfr13I	GGNCC	1 cut(s)	4
CsiI	ACCWGGT	1 cut(s)	6
Csp6I	GTAC	1 cut(s)	82
CviAII	CATG	2 cut(s)	126, 280
CviJI	RGCY	3 cut(s)	150, 185, 202
CviKI_1	RGCY	3 cut(s)	150, 185, 202
CviQI	GTAC	1 cut(s)	82
DdeI	CTNAG	2 cut(s)	38, 225
DpnI	GATC	2 cut(s)	258, 303
DpnII	GATC	2 cut(s)	256, 301
DraI	TTTAAA	1 cut(s)	177
Eco47I	GGWCC	1 cut(s)	4
EcoRII	CCWGG	3 cut(s)	6, 76, 156
FaeI	CATG	2 cut(s)	129, 283
FaiI	YATR	7 cut(s)	69, 98, 127, 242, 244, 266, 281
FalI	AAGNNNNNCTT	2 cut(s)	47, 79
FatI	CATG	2 cut(s)	125, 279
FbaI	TGATCA	1 cut(s)	301
FblI	GTMKAC	1 cut(s)	12
FspBI	CTAG	1 cut(s)	334
Hin1II	CATG	2 cut(s)	129, 283
HincII	GTYRAC	1 cut(s)	13
HindII	GTYRAC	1 cut(s)	13
HphI	GGTGA	1 cut(s)	66
Hpy166II	GTNNAC	1 cut(s)	13
Hpy188I	TCNGA	2 cut(s)	33, 226
Hpy188III	TCNNGA	3 cut(s)	113, 142, 197
Hpy8I	GTNNAC	1 cut(s)	13
HpyAV	CCTTC	1 cut(s)	307
HpyCH4III	ACNGT	1 cut(s)	208
HpyF10VI	GCNNNNNNNGC	1 cut(s)	191
HpyF3I	CTNAG	2 cut(s)	38, 225
Hsp92II	CATG	2 cut(s)	129, 283
KpnI	GGTACC	1 cut(s)	85
Ksp22I	TGATCA	1 cut(s)	301
Kzo9I	GATC	2 cut(s)	256, 301
LmnI	GCTCC	1 cut(s)	109
LpnPI	CCDG	7 cut(s)	20, 40, 63, 90, 98, 143, 170
MabI	ACCWGGT	1 cut(s)	6
MaeI	CTAG	1 cut(s)	334
MalI	GATC	2 cut(s)	258, 303
MbiI	CCGCTC	1 cut(s)	87
MboI	GATC	2 cut(s)	256, 301
MboII	GAAGA	1 cut(s)	128
MfeI	CAATTG	1 cut(s)	321
MflI	RGATCY	1 cut(s)	256
MluCI	AATT	5 cut(s)	164, 172, 217, 305, 321
MnlI	CCTC	1 cut(s)	220
MseI	TTAA	5 cut(s)	18, 48, 122, 176, 308
MspR9I	CCNGG	3 cut(s)	8, 78, 158
MunI	CAATTG	1 cut(s)	321
MvaI	CCWGG	3 cut(s)	8, 78, 158
MwoI	GCNNNNNNNGC	1 cut(s)	191
NdeII	GATC	2 cut(s)	256, 301
NlaIII	CATG	2 cut(s)	129, 283
NlaIV	GGNNCC	1 cut(s)	83
PflFI	GACNNNGTC	1 cut(s)	8
PflMI	CCANNNNNTGG	1 cut(s)	157
Psp6I	CCWGG	3 cut(s)	6, 76, 156
PspGI	CCWGG	3 cut(s)	6, 76, 156
PspN4I	GGNNCC	1 cut(s)	83
PspPI	GGNCC	1 cut(s)	4
PsuI	RGATCY	1 cut(s)	256
PsyI	GACNNNGTC	1 cut(s)	8
RsaI	GTAC	1 cut(s)	83
RsaNI	GTAC	1 cut(s)	82
SalI	GTCGAC	1 cut(s)	11
SaqAI	TTAA	5 cut(s)	18, 48, 122, 176, 308
Sau3AI	GATC	2 cut(s)	256, 301
Sau96I	GGNCC	1 cut(s)	4
ScrFI	CCNGG	3 cut(s)	8, 78, 158
SetI	ASST	7 cut(s)	9, 18, 79, 141, 159, 187, 231
SexAI	ACCWGGT	1 cut(s)	6
SfcI	CTRYAG	1 cut(s)	252
SinI	GGWCC	1 cut(s)	4
SmlI	CTYRAG	1 cut(s)	197
SmoI	CTYRAG	1 cut(s)	197
Sse9I	AATT	5 cut(s)	164, 172, 217, 305, 321
SsiI	CCGC	1 cut(s)	85
SspMI	CTAG	1 cut(s)	334
StyD4I	CCNGG	3 cut(s)	6, 76, 156
TaaI	ACNGT	1 cut(s)	208
TaqI	TCGA	2 cut(s)	12, 92
TasI	AATT	5 cut(s)	164, 172, 217, 305, 321
Tru1I	TTAA	5 cut(s)	18, 48, 122, 176, 308
Tru9I	TTAA	5 cut(s)	18, 48, 122, 176, 308
TspDTI	ATGAA	2 cut(s)	178, 296
Tth111I	GACNNNGTC	1 cut(s)	8
Van91I	CCANNNNNTGG	1 cut(s)	157
VpaK11BI	GGWCC	1 cut(s)	4
XapI	RAATTY	1 cut(s)	172
XmiI	GTMKAC	1 cut(s)	12
XspI	CTAG	1 cut(s)	334

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.