MD04G1053400.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Forward (+)
6312456 .. 6315140
2685 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1053400.v1.1.491

Sequence Viewer

Length: 210 bp
ATGCTATTAGTGATTCTGCCAAAGAATCAAAACAAAGTGGTAGTTTTTATTATGGATACTCACACATTCGAGATGTATACCAGCTCATTGAACAAGAGGACATCTAGCAGTCCAAAGAAGCTCTCTCGGTGCAGCATACACTTTCCTCAATCAAATTTTGACAAGGAGGATCCAGTGAACAATGGAATTGGTGATGATCCAAAGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.83

Weight (kDa)

8.89

Isoelectric Point (pI)

54.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 77
AclWI GGATC 3 cut(s) 164, 177, 191
AcsI RAATTY 1 cut(s) 154
AgsI TTSAA 1 cut(s) 91
AluBI AGCT 2 cut(s) 84, 121
AluI AGCT 2 cut(s) 84, 121
AlwI GGATC 3 cut(s) 164, 177, 191
ApeKI GCWGC 1 cut(s) 132
ApoI RAATTY 1 cut(s) 154
AsuHPI GGTGA 1 cut(s) 203
BamHI GGATCC 1 cut(s) 169
BbvI GCAGC 1 cut(s) 144
BciVI GTATCC 1 cut(s) 49
BfaI CTAG 1 cut(s) 105
BfuI GTATCC 1 cut(s) 49
BisI GCNGC 1 cut(s) 133
BlsI GCNGC 1 cut(s) 134
BmiI GGNNCC 1 cut(s) 171
Bse1I ACTGG 1 cut(s) 173
BseNI ACTGG 1 cut(s) 173
BseXI GCAGC 1 cut(s) 144
BsgI GTGCAG 1 cut(s) 151
Bsp143I GATC 2 cut(s) 169, 196
BspLI GGNNCC 1 cut(s) 171
BspPI GGATC 3 cut(s) 164, 177, 191
BsrI ACTGG 1 cut(s) 173
BssMI GATC 2 cut(s) 169, 196
BssNAI GTATAC 1 cut(s) 78
Bst1107I GTATAC 1 cut(s) 78
BstKTI GATC 2 cut(s) 172, 199
BstMBI GATC 2 cut(s) 169, 196
BstV1I GCAGC 1 cut(s) 144
BstX2I RGATCY 1 cut(s) 169
BstYI RGATCY 1 cut(s) 169
BstZ17I GTATAC 1 cut(s) 78
BsuI GTATCC 1 cut(s) 49
BtsIMutI CAGTG 1 cut(s) 180
CviJI RGCY 2 cut(s) 84, 121
CviKI_1 RGCY 2 cut(s) 84, 121
DpnI GATC 2 cut(s) 171, 198
DpnII GATC 2 cut(s) 169, 196
FaiI YATR 3 cut(s) 53, 78, 137
FblI GTMKAC 1 cut(s) 77
Fnu4HI GCNGC 1 cut(s) 133
Fsp4HI GCNGC 1 cut(s) 133
FspBI CTAG 1 cut(s) 105
GluI GCNGC 1 cut(s) 133
HinfI GANTC 2 cut(s) 13, 25
HphI GGTGA 1 cut(s) 203
Hpy166II GTNNAC 2 cut(s) 78, 178
Hpy188III TCNNGA 1 cut(s) 70
Hpy8I GTNNAC 2 cut(s) 78, 178
HpyCH4V TGCA 1 cut(s) 132
Kzo9I GATC 2 cut(s) 169, 196
LpnPI CCDG 2 cut(s) 94, 186
Lsp1109I GCAGC 1 cut(s) 144
MaeI CTAG 1 cut(s) 105
MalI GATC 2 cut(s) 171, 198
MboI GATC 2 cut(s) 169, 196
MflI RGATCY 1 cut(s) 169
MluCI AATT 2 cut(s) 154, 186
MnlI CCTC 3 cut(s) 90, 156, 160
MseI TTAA 1 cut(s) 208
NdeII GATC 2 cut(s) 169, 196
NlaIV GGNNCC 1 cut(s) 171
PfeI GAWTC 2 cut(s) 13, 25
PkrI GCNGC 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 171
PsuI RGATCY 1 cut(s) 169
SaqAI TTAA 1 cut(s) 208
SatI GCNGC 1 cut(s) 133
Sau3AI GATC 2 cut(s) 169, 196
SetI ASST 2 cut(s) 86, 123
SgeI CNNG 7 cut(s) 82, 93, 106, 117, 138, 175, 185
Sse9I AATT 2 cut(s) 154, 186
SspMI CTAG 1 cut(s) 105
TaqI TCGA 1 cut(s) 69
TasI AATT 2 cut(s) 154, 186
TfiI GAWTC 2 cut(s) 13, 25
Tru1I TTAA 1 cut(s) 208
Tru9I TTAA 1 cut(s) 208
TscAI CASTG 1 cut(s) 180
TseI GCWGC 1 cut(s) 132
TspRI CASTG 1 cut(s) 180
XapI RAATTY 1 cut(s) 154
XmiI GTMKAC 1 cut(s) 77
XspI CTAG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.