Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5A

Orthogroup ID

OG0002392

Physical Location & Seq

Genomic Coordinates Forward (+)

6658085 .. 6660451

Gene Structure 2367 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5AG077800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 129 bp

ATGGGGACTTTCAGGATTATACATATTGAAGGGGGAGAGATTTGGACTGAAAACAAAGAAAAGAGTAATGTTGGATTGAGATTCGTCTTTGACACAGCAGAAGTGTTTCATTTTCGTGCCTTCTCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

42

Amino Acids

4.92

Weight (kDa)

6.02

Isoelectric Point (pI)

46.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002392)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G21810 AT3G21810
fragaria_vesca	FvH4_6g43530 FvH4_6g43530 FvH4_6g43530 FvH4_6g43530
malus_domestica	MD04G1053400.v1.1 MD04G1053600.v1.1 MD09G1105200.v1.1
prunus_persica	Prupe.3G220100_v2.0.a1 Prupe.3G220100_v2.0.a1
pyrus_communis	pycom05g17840 pycom09g02830
rosa_chinensis	RchiOBHm_Chr2g0160051 RchiOBHm_Chr2g0160061
rosa_laevigata	RLG00000021194
rosa_multiflora	Rmu_sc0002023.1_g000015 Rmu_sc0013519.1_g000001
rosa_roxburghii	Rroxscaffold_2G00090060 Rroxscaffold_4G00309610
rosa_rugosa	Rorug01G0120500 Rorug02G0480000 Rorug02G0480000 Rorug02G0480100 Rorug02G0480100 Rorug02G0480200 Rorug03G0356600 Rorug03G0356700 Rorug03G0356800 Rorug06G0182300
rosa_samantha	Rh1AG135100 Rh1BG158100 Rh2AG546600 Rh2BG560000 Rh2CG530000 Rh2DG568700 Rh4CG275700 Rh5AG077800 Rh5AG298500 Rh7BG126200
rosa_wichuraiana	Rw2G012000 Rw2G045200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	29
Asp700I	GAANNNNTTC	1 cut(s)	105
BslFI	GGGAC	1 cut(s)	19
BsmFI	GGGAC	1 cut(s)	19
FaiI	YATR	2 cut(s)	20, 24
FaqI	GGGAC	1 cut(s)	19
FspEI	CC	6 cut(s)	15, 16, 17, 18, 28, 57
HinfI	GANTC	1 cut(s)	81
Hpy188III	TCNNGA	1 cut(s)	13
HpyAV	CCTTC	1 cut(s)	23
MmeI	TCCRAC	1 cut(s)	52
MroXI	GAANNNNTTC	1 cut(s)	105
MseI	TTAA	1 cut(s)	127
MslI	CAYNNNNRTG	1 cut(s)	114
PdmI	GAANNNNTTC	1 cut(s)	105
PfeI	GAWTC	1 cut(s)	81
RseI	CAYNNNNRTG	1 cut(s)	114
SaqAI	TTAA	1 cut(s)	127
SgeI	CNNG	1 cut(s)	25
SmiMI	CAYNNNNRTG	1 cut(s)	114
TfiI	GAWTC	1 cut(s)	81
Tru1I	TTAA	1 cut(s)	127
Tru9I	TTAA	1 cut(s)	127
TspDTI	ATGAA	1 cut(s)	98
XmnI	GAANNNNTTC	1 cut(s)	105

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.