Rh1AG135100

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
25762795 .. 25768199
5405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG135100.1

Sequence Viewer

Length: 285 bp
ATGGAGGCGTGGATCGCCAAAGGGACTTTCAGGATTGTACATATTGAAGGGGGAGAGATTTGGACTGAAAACAAAGAAAAGAGATCAAATATTATCCAGAACATGAATTATACTGTTCACAGCATGTTTTCTATGTTTGAAGCACGCAGGATCTCCCATAAAGTTGAGAAGTTTGTAAAAGTACATTCTCATCATTCAAGAATAGAAGACCAACTTAAGAGATCACAGGTCCAACTAAATAACTTGGGAGATCAGCTTGGTCTAGATACTTATGGCCGAACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

11.08

Weight (kDa)

9.45

Isoelectric Point (pI)

56.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 20, 158
AcoI YGGCCR 1 cut(s) 274
AfaI GTAC 2 cut(s) 39, 183
AflII CTTAAG 1 cut(s) 215
AgsI TTSAA 3 cut(s) 47, 140, 198
AjuI GAANNNNNNNTTGG 2 cut(s) 11, 43
AluBI AGCT 1 cut(s) 256
AluI AGCT 1 cut(s) 256
AlwI GGATC 2 cut(s) 20, 158
AoxI GGCC 1 cut(s) 274
AspS9I GGNCC 1 cut(s) 229
AvaII GGWCC 1 cut(s) 229
BbsI GAAGAC 1 cut(s) 213
BfaI CTAG 1 cut(s) 263
BfrI CTTAAG 1 cut(s) 215
Bme18I GGWCC 1 cut(s) 229
BmgT120I GGNCC 1 cut(s) 229
BpiI GAAGAC 1 cut(s) 213
BshFI GGCC 1 cut(s) 276
BslFI GGGAC 1 cut(s) 37
BsmFI GGGAC 1 cut(s) 37
BsnI GGCC 1 cut(s) 276
Bsp1407I TGTACA 1 cut(s) 37
Bsp143I GATC 5 cut(s) 12, 83, 150, 221, 250
BspANI GGCC 1 cut(s) 276
BspPI GGATC 2 cut(s) 20, 158
BspTI CTTAAG 1 cut(s) 215
BsrGI TGTACA 1 cut(s) 37
BssMI GATC 5 cut(s) 12, 83, 150, 221, 250
Bst4CI ACNGT 1 cut(s) 115
BstAFI CTTAAG 1 cut(s) 215
BstAUI TGTACA 1 cut(s) 37
BstC8I GCNNGC 1 cut(s) 145
BstKTI GATC 5 cut(s) 15, 86, 153, 224, 253
BstMBI GATC 5 cut(s) 12, 83, 150, 221, 250
BstMWI GCNNNNNNNGC 1 cut(s) 14
BstNSI RCATGY 1 cut(s) 127
BstV2I GAAGAC 1 cut(s) 213
BstX2I RGATCY 1 cut(s) 150
BstYI RGATCY 1 cut(s) 150
BsuRI GGCC 1 cut(s) 276
Cac8I GCNNGC 1 cut(s) 145
Cfr13I GGNCC 1 cut(s) 229
Csp6I GTAC 2 cut(s) 38, 182
CviAII CATG 2 cut(s) 103, 124
CviJI RGCY 2 cut(s) 256, 276
CviKI_1 RGCY 2 cut(s) 256, 276
CviQI GTAC 2 cut(s) 38, 182
DpnI GATC 5 cut(s) 14, 85, 152, 223, 252
DpnII GATC 5 cut(s) 12, 83, 150, 221, 250
EaeI YGGCCR 1 cut(s) 274
Eco47I GGWCC 1 cut(s) 229
FaeI CATG 2 cut(s) 106, 127
FaiI YATR 7 cut(s) 42, 104, 111, 125, 134, 159, 273
FalI AAGNNNNNCTT 2 cut(s) 198, 230
FaqI GGGAC 1 cut(s) 37
FatI CATG 2 cut(s) 102, 123
FspBI CTAG 1 cut(s) 263
HaeIII GGCC 1 cut(s) 276
Hin1II CATG 2 cut(s) 106, 127
Hpy166II GTNNAC 1 cut(s) 118
Hpy188III TCNNGA 4 cut(s) 31, 97, 198, 263
Hpy8I GTNNAC 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 41
HpyCH4III ACNGT 1 cut(s) 115
HpyF10VI GCNNNNNNNGC 1 cut(s) 14
Hsp92II CATG 2 cut(s) 106, 127
Kzo9I GATC 5 cut(s) 12, 83, 150, 221, 250
LpnPI CCDG 4 cut(s) 16, 110, 133, 212
MaeI CTAG 1 cut(s) 263
MalI GATC 5 cut(s) 14, 85, 152, 223, 252
MboI GATC 5 cut(s) 12, 83, 150, 221, 250
MboII GAAGA 1 cut(s) 218
MflI RGATCY 1 cut(s) 150
MluCI AATT 1 cut(s) 106
MmeI TCCRAC 1 cut(s) 256
MseI TTAA 1 cut(s) 216
MspCI CTTAAG 1 cut(s) 215
MwoI GCNNNNNNNGC 1 cut(s) 14
NdeII GATC 5 cut(s) 12, 83, 150, 221, 250
NlaIII CATG 2 cut(s) 106, 127
NspI RCATGY 1 cut(s) 127
PspPI GGNCC 1 cut(s) 229
PsuI RGATCY 1 cut(s) 150
RsaI GTAC 2 cut(s) 39, 183
RsaNI GTAC 2 cut(s) 38, 182
SaqAI TTAA 1 cut(s) 216
Sau3AI GATC 5 cut(s) 12, 83, 150, 221, 250
Sau96I GGNCC 1 cut(s) 229
SetI ASST 2 cut(s) 231, 258
SinI GGWCC 1 cut(s) 229
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 1 cut(s) 106
SspI AATATT 1 cut(s) 91
SspMI CTAG 1 cut(s) 263
TaaI ACNGT 1 cut(s) 115
TasI AATT 1 cut(s) 106
TatI WGTACW 2 cut(s) 37, 181
Tru1I TTAA 1 cut(s) 216
Tru9I TTAA 1 cut(s) 216
TspDTI ATGAA 1 cut(s) 119
Vha464I CTTAAG 1 cut(s) 215
VpaK11BI GGWCC 1 cut(s) 229
XbaI TCTAGA 1 cut(s) 262
XceI RCATGY 1 cut(s) 127
XspI CTAG 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.