Rroxscaffold_4G00309610

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
31380241 .. 31387176
6936 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00309610.1

Sequence Viewer

Length: 162 bp
ATGGCGTTGTATCATAGTTTGTATATCTGGGCAACTAGGTGCTCAGTCCAACTAAATAAGTTGGGAGATCAGCTTGGTTTAGATACGTATGGAATTGATGTCAATGAAGAGGAAGCATTAATATTGTCAGCAATGGGGAAACTCACTTTCCAGTCCCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.92

Weight (kDa)

4.58

Isoelectric Point (pI)

40.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
Alw21I GWGCWC 1 cut(s) 44
AseI ATTAAT 1 cut(s) 119
Bbv12I GWGCWC 1 cut(s) 44
BfaI CTAG 1 cut(s) 36
BsaAI YACGTR 1 cut(s) 87
Bse1I ACTGG 1 cut(s) 151
Bse3DI GCAATG 1 cut(s) 138
BseMI GCAATG 1 cut(s) 138
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 1 cut(s) 151
BsiHKAI GWGCWC 1 cut(s) 44
BslFI GGGAC 1 cut(s) 139
BsmFI GGGAC 1 cut(s) 139
Bsp1286I GDGCHC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 67
BspCNI CTCAG 1 cut(s) 56
BsrDI GCAATG 1 cut(s) 138
BsrI ACTGG 1 cut(s) 151
BssMI GATC 1 cut(s) 67
Bst6I CTCTTC 1 cut(s) 102
BstBAI YACGTR 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 43
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
BstSNI TACGTA 1 cut(s) 87
CviJI RGCY 1 cut(s) 73
CviKI_1 RGCY 1 cut(s) 73
DdeI CTNAG 1 cut(s) 43
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
Eam1104I CTCTTC 1 cut(s) 102
EarI CTCTTC 1 cut(s) 102
Eco105I TACGTA 1 cut(s) 87
FaiI YATR 3 cut(s) 15, 24, 90
FaqI GGGAC 1 cut(s) 139
FspBI CTAG 1 cut(s) 36
HpyCH4IV ACGT 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 43
HpySE526I ACGT 1 cut(s) 86
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 1 cut(s) 13
MaeI CTAG 1 cut(s) 36
MaeII ACGT 1 cut(s) 86
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MboII GAAGA 1 cut(s) 119
MhlI GDGCHC 1 cut(s) 44
MluCI AATT 1 cut(s) 93
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 1 cut(s) 103
MseI TTAA 2 cut(s) 119, 160
NdeII GATC 1 cut(s) 67
Ppu21I YACGTR 1 cut(s) 87
PshBI ATTAAT 1 cut(s) 119
SaqAI TTAA 2 cut(s) 119, 160
Sau3AI GATC 1 cut(s) 67
SduI GDGCHC 1 cut(s) 44
SetI ASST 3 cut(s) 41, 75, 89
SgeI CNNG 3 cut(s) 40, 48, 86
SnaBI TACGTA 1 cut(s) 87
Sse9I AATT 1 cut(s) 93
SspI AATATT 1 cut(s) 123
SspMI CTAG 1 cut(s) 36
TaiI ACGT 1 cut(s) 89
TasI AATT 1 cut(s) 93
Tru1I TTAA 2 cut(s) 119, 160
Tru9I TTAA 2 cut(s) 119, 160
TspDTI ATGAA 1 cut(s) 120
VspI ATTAAT 1 cut(s) 119
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.