MD04G1053600.v1.1

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Forward (+)
6329682 .. 6345197
15516 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1053600.v1.1.491

Sequence Viewer

Length: 318 bp
ATGCACTGGGATTCGAGCATTAATATTGTCAGTAATGGTGAGACTACTGGTTTTCCAGTCACCCCACATAATGAGCAGCTGAGTTATGCATCTACAAGCAAGAAAAGGCTGGATACTATTAGTGATTTTGCCAAAGAATCAAAACAAAGTGTTTTTATTATGGATACTCACACATTCGAGATGTGTACCAGCTCATTGAACAAGAGGACATCTAGCAGTCCAAAGAAGCTCTCTCGGTGCAGCATACACCTTCCTCAATCAAATTTTGACAAGGATGATCCAGTGAACAATGGAATTGGTGATGATCCAAAGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.68

Weight (kDa)

6.39

Isoelectric Point (pI)

63.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 272, 299
AcsI RAATTY 1 cut(s) 262
AfaI GTAC 1 cut(s) 187
AgsI TTSAA 1 cut(s) 199
AluBI AGCT 3 cut(s) 79, 192, 229
AluI AGCT 3 cut(s) 79, 192, 229
Alw26I GTCTC 1 cut(s) 35
AlwI GGATC 2 cut(s) 272, 299
ApeKI GCWGC 2 cut(s) 76, 240
ApoI RAATTY 1 cut(s) 262
AseI ATTAAT 1 cut(s) 21
AsuHPI GGTGA 3 cut(s) 50, 52, 311
BbvI GCAGC 2 cut(s) 88, 252
BciVI GTATCC 2 cut(s) 106, 157
BcoDI GTCTC 1 cut(s) 35
BfaI CTAG 1 cut(s) 213
BfuI GTATCC 2 cut(s) 106, 157
BisI GCNGC 2 cut(s) 77, 241
BlsI GCNGC 2 cut(s) 78, 242
BmrI ACTGGG 1 cut(s) 16
BmsI GCATC 1 cut(s) 98
BmuI ACTGGG 1 cut(s) 16
Bse1I ACTGG 4 cut(s) 11, 52, 56, 281
BseGI GGATG 1 cut(s) 280
BseMII CTCAG 1 cut(s) 71
BseNI ACTGG 4 cut(s) 11, 52, 56, 281
BseXI GCAGC 2 cut(s) 88, 252
BsgI GTGCAG 1 cut(s) 259
BsmAI GTCTC 1 cut(s) 35
Bsp143I GATC 2 cut(s) 277, 304
BspCNI CTCAG 1 cut(s) 72
BspPI GGATC 2 cut(s) 272, 299
BsrI ACTGG 4 cut(s) 11, 52, 56, 281
BssMI GATC 2 cut(s) 277, 304
BstDEI CTNAG 1 cut(s) 80
BstF5I GGATG 1 cut(s) 280
BstKTI GATC 2 cut(s) 280, 307
BstMAI GTCTC 1 cut(s) 35
BstMBI GATC 2 cut(s) 277, 304
BstV1I GCAGC 2 cut(s) 88, 252
BsuI GTATCC 2 cut(s) 106, 157
BtsCI GGATG 1 cut(s) 280
BtsIMutI CAGTG 2 cut(s) 4, 288
Csp6I GTAC 1 cut(s) 186
CviJI RGCY 4 cut(s) 79, 109, 192, 229
CviKI_1 RGCY 4 cut(s) 79, 109, 192, 229
CviQI GTAC 1 cut(s) 186
DdeI CTNAG 1 cut(s) 80
DpnI GATC 2 cut(s) 279, 306
DpnII GATC 2 cut(s) 277, 304
EcoT22I ATGCAT 1 cut(s) 91
FaiI YATR 4 cut(s) 69, 87, 161, 245
Fnu4HI GCNGC 2 cut(s) 77, 241
FokI GGATG 1 cut(s) 287
Fsp4HI GCNGC 2 cut(s) 77, 241
FspBI CTAG 1 cut(s) 213
GluI GCNGC 2 cut(s) 77, 241
HinfI GANTC 2 cut(s) 11, 137
HphI GGTGA 3 cut(s) 50, 52, 311
Hpy166II GTNNAC 2 cut(s) 186, 286
Hpy188III TCNNGA 1 cut(s) 178
Hpy8I GTNNAC 2 cut(s) 186, 286
HpyAV CCTTC 1 cut(s) 260
HpyCH4V TGCA 3 cut(s) 4, 89, 240
HpyF3I CTNAG 1 cut(s) 80
Kzo9I GATC 2 cut(s) 277, 304
LpnPI CCDG 5 cut(s) 33, 69, 95, 202, 294
Lsp1109I GCAGC 2 cut(s) 88, 252
LweI GCATC 1 cut(s) 98
MaeI CTAG 1 cut(s) 213
MaeIII GTNAC 1 cut(s) 58
MalI GATC 2 cut(s) 279, 306
MboI GATC 2 cut(s) 277, 304
MluCI AATT 2 cut(s) 262, 294
MnlI CCTC 2 cut(s) 198, 264
Mph1103I ATGCAT 1 cut(s) 91
MseI TTAA 2 cut(s) 21, 316
MspA1I CMGCKG 1 cut(s) 79
NdeII GATC 2 cut(s) 277, 304
NmuCI GTSAC 1 cut(s) 58
NsiI ATGCAT 1 cut(s) 91
PfeI GAWTC 2 cut(s) 11, 137
PkrI GCNGC 2 cut(s) 78, 242
PshBI ATTAAT 1 cut(s) 21
PvuII CAGCTG 1 cut(s) 79
RsaI GTAC 1 cut(s) 187
RsaNI GTAC 1 cut(s) 186
SaqAI TTAA 2 cut(s) 21, 316
SatI GCNGC 2 cut(s) 77, 241
Sau3AI GATC 2 cut(s) 277, 304
SetI ASST 4 cut(s) 81, 194, 231, 252
SfaNI GCATC 1 cut(s) 98
Sse9I AATT 2 cut(s) 262, 294
SspI AATATT 1 cut(s) 25
SspMI CTAG 1 cut(s) 213
TaqI TCGA 2 cut(s) 14, 177
TasI AATT 2 cut(s) 262, 294
TfiI GAWTC 2 cut(s) 11, 137
Tru1I TTAA 2 cut(s) 21, 316
Tru9I TTAA 2 cut(s) 21, 316
TscAI CASTG 1 cut(s) 288
TseFI GTSAC 1 cut(s) 58
TseI GCWGC 2 cut(s) 76, 240
Tsp45I GTSAC 1 cut(s) 58
TspRI CASTG 1 cut(s) 288
VspI ATTAAT 1 cut(s) 21
XapI RAATTY 1 cut(s) 262
XspI CTAG 1 cut(s) 213
Zsp2I ATGCAT 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.