MD05G1309200.v1.1

Protein of unknown function, DUF599

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0001932
Physical Location & Seq
Forward (+)
43991713 .. 43992371
659 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1309200.v1.1.491

Sequence Viewer

Length: 519 bp
ATGAGATTAGAAGCTATGGATTTTCTGCATTTTCAGAAAGAGTGCTTAGATGTGGTGTTGGCCCCAAGTGGGCTCTTGATCATGCTAATCTACCACTTCTTCCTCCTCTACAAATACGTCAATTACCCTCTTTCCACCGCCATCGGTTCTGAAAACAATGACAAGAAAGTTTGGGTTGGAAAAATCTTGCAGGGTGAAGATGTTCAAGTTGCAAAGAAAGTTAAAACAGCTCTTGATGTGATTTCCTCCAATACAAGTGCAACTACGTCCTTAGCACCAATCTCTCTAACTCTCTGTGCTCTCATTGGAGCTTGGATGGCAAACTCCAACAACAACAACTTCCCAAAGCAAATAATATATGGCAACACAAACCCTTCAACTATTTCCATCAAGTACATCTGCATCTTGACATTTTTTCTCCTTGCTTTTTCATGCTTTTGTTCAATTAGCCAGGCACTTGGTCCACTCAGAGCAAGTCCATTCCTCCTTTGGAGGCTGGCCCAAAGCCCAAAAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF599

Protein Analysis

173

Amino Acids

19.13

Weight (kDa)

9.13

Isoelectric Point (pI)

35.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF599 PF04654 19 - 147 1.5e-24 Protein of unknown function, DUF599
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 138
AfaI GTAC 1 cut(s) 395
AfiI CCNNNNNNNGG 1 cut(s) 69
AgsI TTSAA 3 cut(s) 206, 378, 444
AjnI CCWGG 1 cut(s) 450
AluBI AGCT 3 cut(s) 14, 230, 311
AluI AGCT 3 cut(s) 14, 230, 311
Alw21I GWGCWC 1 cut(s) 301
AoxI GGCC 2 cut(s) 60, 498
Asp700I GAANNNNTTC 1 cut(s) 201
AspS9I GGNCC 3 cut(s) 61, 461, 499
AsuHPI GGTGA 1 cut(s) 206
AvaII GGWCC 1 cut(s) 461
BanII GRGCYC 1 cut(s) 75
Bbv12I GWGCWC 1 cut(s) 301
BccI CCATC 3 cut(s) 149, 310, 395
BciT130I CCWGG 1 cut(s) 452
BclI TGATCA 1 cut(s) 78
Bme1390I CCNGG 1 cut(s) 452
Bme18I GGWCC 1 cut(s) 461
BmgT120I GGNCC 3 cut(s) 61, 461, 499
BmiI GGNNCC 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 452
BmsI GCATC 1 cut(s) 411
Bpu10I CCTNAGC 1 cut(s) 271
Bsc4I CCNNNNNNNGG 1 cut(s) 69
BseBI CCWGG 1 cut(s) 452
BseGI GGATG 1 cut(s) 321
BseLI CCNNNNNNNGG 1 cut(s) 69
BseMII CTCAG 1 cut(s) 481
BseRI GAGGAG 1 cut(s) 95
BshFI GGCC 2 cut(s) 62, 500
BsiHKAI GWGCWC 1 cut(s) 301
BslI CCNNNNNNNGG 1 cut(s) 69
BsnI GGCC 2 cut(s) 62, 500
Bsp1286I GDGCHC 2 cut(s) 75, 301
Bsp143I GATC 1 cut(s) 78
BspACI CCGC 1 cut(s) 138
BspANI GGCC 2 cut(s) 62, 500
BspCNI CTCAG 1 cut(s) 480
BspLI GGNNCC 1 cut(s) 63
BssMI GATC 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 452
BstC8I GCNNGC 1 cut(s) 498
BstDEI CTNAG 3 cut(s) 46, 271, 467
BstF5I GGATG 1 cut(s) 321
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstMWI GCNNNNNNNGC 1 cut(s) 317
BstNI CCWGG 1 cut(s) 452
BstSCI CCNGG 1 cut(s) 450
BstXI CCANNNNNNTGG 1 cut(s) 458
BsuRI GGCC 2 cut(s) 62, 500
BtsCI GGATG 1 cut(s) 321
Cac8I GCNNGC 1 cut(s) 498
Cfr13I GGNCC 3 cut(s) 61, 461, 499
Csp6I GTAC 1 cut(s) 394
CviAII CATG 2 cut(s) 82, 432
CviJI RGCY 9 cut(s) 14, 62, 73, 230, 311, 450, 496, 500, 507
CviKI_1 RGCY 9 cut(s) 14, 62, 73, 230, 311, 450, 496, 500, 507
CviQI GTAC 1 cut(s) 394
DdeI CTNAG 3 cut(s) 46, 271, 467
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
Eco24I GRGCYC 1 cut(s) 75
Eco47I GGWCC 1 cut(s) 461
EcoRII CCWGG 1 cut(s) 450
EcoT38I GRGCYC 1 cut(s) 75
FaeI CATG 2 cut(s) 85, 435
FaiI YATR 5 cut(s) 17, 83, 358, 360, 433
FatI CATG 2 cut(s) 81, 431
FbaI TGATCA 1 cut(s) 78
FokI GGATG 1 cut(s) 328
FriOI GRGCYC 1 cut(s) 75
HaeIII GGCC 2 cut(s) 62, 500
Hin1II CATG 2 cut(s) 85, 435
HphI GGTGA 1 cut(s) 206
Hpy166II GTNNAC 1 cut(s) 464
Hpy188I TCNGA 3 cut(s) 36, 151, 470
Hpy188III TCNNGA 3 cut(s) 76, 233, 406
Hpy8I GTNNAC 1 cut(s) 464
HpyAV CCTTC 1 cut(s) 384
HpyCH4IV ACGT 2 cut(s) 117, 266
HpyCH4V TGCA 5 cut(s) 28, 190, 212, 260, 402
HpyF10VI GCNNNNNNNGC 1 cut(s) 317
HpyF3I CTNAG 3 cut(s) 46, 271, 467
HpySE526I ACGT 2 cut(s) 117, 266
Hsp92II CATG 2 cut(s) 85, 435
Ksp22I TGATCA 1 cut(s) 78
Kzo9I GATC 1 cut(s) 78
LmnI GCTCC 1 cut(s) 308
LpnPI CCDG 4 cut(s) 176, 437, 464, 482
LweI GCATC 1 cut(s) 411
MaeII ACGT 2 cut(s) 117, 266
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 2 cut(s) 91, 209
MhlI GDGCHC 2 cut(s) 75, 301
MluCI AATT 2 cut(s) 121, 444
MmeI TCCRAC 2 cut(s) 157, 351
MnlI CCTC 6 cut(s) 113, 116, 138, 256, 486, 494
MroXI GAANNNNTTC 1 cut(s) 201
MseI TTAA 1 cut(s) 222
MspR9I CCNGG 1 cut(s) 452
MvaI CCWGG 1 cut(s) 452
MwoI GCNNNNNNNGC 1 cut(s) 317
NdeII GATC 1 cut(s) 78
NlaIII CATG 2 cut(s) 85, 435
NlaIV GGNNCC 1 cut(s) 63
PdmI GAANNNNTTC 1 cut(s) 201
Psp6I CCWGG 1 cut(s) 450
PspGI CCWGG 1 cut(s) 450
PspN4I GGNNCC 1 cut(s) 63
PspPI GGNCC 3 cut(s) 61, 461, 499
RsaI GTAC 1 cut(s) 395
RsaNI GTAC 1 cut(s) 394
SaqAI TTAA 1 cut(s) 222
Sau3AI GATC 1 cut(s) 78
Sau96I GGNCC 3 cut(s) 61, 461, 499
ScrFI CCNGG 1 cut(s) 452
SduI GDGCHC 2 cut(s) 75, 301
SetI ASST 5 cut(s) 16, 120, 232, 269, 313
SfaNI GCATC 1 cut(s) 411
SinI GGWCC 1 cut(s) 461
Sse9I AATT 2 cut(s) 121, 444
SsiI CCGC 1 cut(s) 138
StyD4I CCNGG 1 cut(s) 450
TaiI ACGT 2 cut(s) 120, 269
TasI AATT 2 cut(s) 121, 444
TatI WGTACW 1 cut(s) 393
Tru1I TTAA 1 cut(s) 222
Tru9I TTAA 1 cut(s) 222
TspDTI ATGAA 1 cut(s) 420
VpaK11BI GGWCC 1 cut(s) 461
XcmI CCANNNNNNNNNTGG 1 cut(s) 486
XmnI GAANNNNTTC 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.