Prupe.4G054100_v2.0.a1

Protein of unknown function, DUF599

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
2613912 .. 2615119
1208 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G054100.1

Sequence Viewer

Length: 714 bp
ATGGATTTTAAGAACTTTCAGGAGGAGTATCTGGATATGGTGTTGGTACCAAGTGGGCTATTGATCATGCTAATTTACCACCTCTTCCTCCTCTATAAGTACCTCAAACATCCTCTCTCCACAGCCATGGGCTATGAAAACAAGGACAAAAAAACTTGGGTTGGAAAAATTCTTCAGGGTCAAGATAGTGCTACAGCTGTCACTGTGATTTCCACCAATACAACTGCAACTATTTACTTGGCAACAATCTCTTTAACTCTTTGTTCTCTCATTGGAGCTTGGATGGCAAAATCCACCAACAATTTCTTCCCAAGAGAAATAATATATGGCAACACAAGCCCATCCATTATTTCTATCAAGTACATTTGCCTCTTGACCTGTTTTCTCCTGGCTTTTTCATGCTTTGTTCAATCAGCCAGGCACCTTGTCCATTCAAACTACCTGCTAAGCACTCCAGGAGCTACTTCTAAAGCTGATGTGAGAAAAGCTAAGAGAGCGGTTGAAAAGGGAAGTGAATTTTGGTCACTGGGGCTTAGAGCACTATATTTTGCTCTTAATTTTCTGCTATGGTTTTTTGGACCTGTGCCCATGTTTGTTTCGTCTGTCACAACGGTTGTGATCTTATCTTGCCACGACTTCAAGAGGTCAGATAATAATCAAAAGTGGCCTGCCTCAGCTGTGGCTGTAAATGAAAGTGCATTATTAATTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

238

Amino Acids

26.54

Weight (kDa)

9.15

Isoelectric Point (pI)

31.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 450
Acc65I GGTACC 1 cut(s) 46
AccB1I GGYRCC 2 cut(s) 46, 420
AccBSI CCGCTC 1 cut(s) 497
AciI CCGC 1 cut(s) 497
AcsI RAATTY 2 cut(s) 168, 515
AcuI CTGAAG 1 cut(s) 158
AfaI GTAC 3 cut(s) 48, 101, 362
AgsI TTSAA 4 cut(s) 410, 435, 503, 640
AjnI CCWGG 3 cut(s) 387, 416, 454
AjuI GAANNNNNNNTTGG 4 cut(s) 290, 322, 502, 534
AluBI AGCT 6 cut(s) 197, 278, 461, 473, 488, 677
AluI AGCT 6 cut(s) 197, 278, 461, 473, 488, 677
Alw21I GWGCWC 1 cut(s) 541
AoxI GGCC 1 cut(s) 665
ApoI RAATTY 2 cut(s) 168, 515
AseI ATTAAT 1 cut(s) 704
Asp718I GGTACC 1 cut(s) 46
AspS9I GGNCC 1 cut(s) 578
AvaII GGWCC 1 cut(s) 578
BaeGI GKGCMC 1 cut(s) 588
BanI GGYRCC 2 cut(s) 46, 420
Bbv12I GWGCWC 1 cut(s) 541
BbvCI CCTCAGC 1 cut(s) 673
BccI CCATC 2 cut(s) 277, 349
BciT130I CCWGG 3 cut(s) 389, 418, 456
BclI TGATCA 1 cut(s) 63
BfmI CTRYAG 1 cut(s) 192
BfuAI ACCTGC 1 cut(s) 450
BlpI GCTNAGC 1 cut(s) 446
Bme1390I CCNGG 3 cut(s) 389, 418, 456
Bme18I GGWCC 1 cut(s) 578
BmgT120I GGNCC 1 cut(s) 578
BmiI GGNNCC 2 cut(s) 48, 422
BmrFI CCNGG 3 cut(s) 389, 418, 456
BmrI ACTGGG 1 cut(s) 536
BmuI ACTGGG 1 cut(s) 536
BpmI CTGGAG 1 cut(s) 438
Bpu10I CCTNAGC 1 cut(s) 673
Bpu1102I GCTNAGC 1 cut(s) 446
BsaBI GATNNNNATC 1 cut(s) 654
BsaJI CCNNGG 1 cut(s) 126
Bse1I ACTGG 1 cut(s) 531
Bse8I GATNNNNATC 1 cut(s) 654
BseBI CCWGG 3 cut(s) 389, 418, 456
BseDI CCNNGG 1 cut(s) 126
BseGI GGATG 3 cut(s) 109, 288, 341
BseJI GATNNNNATC 1 cut(s) 654
BseMII CTCAG 1 cut(s) 687
BseNI ACTGG 1 cut(s) 531
BseRI GAGGAG 2 cut(s) 38, 80
BseSI GKGCMC 1 cut(s) 588
BshFI GGCC 1 cut(s) 667
BshNI GGYRCC 2 cut(s) 46, 420
BsiHKAI GWGCWC 1 cut(s) 541
BsnI GGCC 1 cut(s) 667
Bsp1286I GDGCHC 2 cut(s) 541, 588
Bsp143I GATC 2 cut(s) 63, 618
Bsp1720I GCTNAGC 1 cut(s) 446
Bsp19I CCATGG 1 cut(s) 126
BspACI CCGC 1 cut(s) 497
BspANI GGCC 1 cut(s) 667
BspCNI CTCAG 1 cut(s) 686
BspLI GGNNCC 2 cut(s) 48, 422
BspMI ACCTGC 1 cut(s) 450
BspT107I GGYRCC 2 cut(s) 46, 420
BsrBI CCGCTC 1 cut(s) 497
BsrI ACTGG 1 cut(s) 531
BssECI CCNNGG 1 cut(s) 126
BssMI GATC 2 cut(s) 63, 618
BssT1I CCWWGG 1 cut(s) 126
Bst2UI CCWGG 3 cut(s) 389, 418, 456
Bst4CI ACNGT 2 cut(s) 205, 613
Bst6I CTCTTC 1 cut(s) 89
BstC8I GCNNGC 1 cut(s) 669
BstDEI CTNAG 4 cut(s) 446, 489, 533, 673
BstDSI CCRYGG 1 cut(s) 126
BstF5I GGATG 3 cut(s) 109, 288, 341
BstKTI GATC 2 cut(s) 66, 621
BstMBI GATC 2 cut(s) 63, 618
BstMWI GCNNNNNNNGC 3 cut(s) 284, 336, 494
BstNI CCWGG 3 cut(s) 389, 418, 456
BstSCI CCNGG 3 cut(s) 387, 416, 454
BstSFI CTRYAG 1 cut(s) 192
BstSLI GKGCMC 1 cut(s) 588
BstXI CCANNNNNNTGG 1 cut(s) 127
BsuRI GGCC 1 cut(s) 667
BtgI CCRYGG 1 cut(s) 126
BtsCI GGATG 3 cut(s) 109, 288, 341
BtsIMutI CAGTG 2 cut(s) 201, 524
BveI ACCTGC 1 cut(s) 450
Cac8I GCNNGC 1 cut(s) 669
Cfr13I GGNCC 1 cut(s) 578
Csp6I GTAC 3 cut(s) 47, 100, 361
CviAII CATG 4 cut(s) 67, 127, 399, 589
CviQI GTAC 3 cut(s) 47, 100, 361
DdeI CTNAG 4 cut(s) 446, 489, 533, 673
DpnI GATC 2 cut(s) 65, 620
DpnII GATC 2 cut(s) 63, 618
Eam1104I CTCTTC 1 cut(s) 89
EarI CTCTTC 1 cut(s) 89
Eco130I CCWWGG 1 cut(s) 126
Eco47I GGWCC 1 cut(s) 578
Eco57I CTGAAG 1 cut(s) 158
EcoRII CCWGG 3 cut(s) 387, 416, 454
EcoT14I CCWWGG 1 cut(s) 126
ErhI CCWWGG 1 cut(s) 126
FaeI CATG 4 cut(s) 70, 130, 402, 592
FatI CATG 4 cut(s) 66, 126, 398, 588
FbaI TGATCA 1 cut(s) 63
FokI GGATG 3 cut(s) 96, 295, 328
GsuI CTGGAG 1 cut(s) 438
HaeIII GGCC 1 cut(s) 667
Hin1II CATG 4 cut(s) 70, 130, 402, 592
Hpy188I TCNGA 1 cut(s) 649
Hpy188III TCNNGA 6 cut(s) 20, 32, 182, 373, 640, 711
HpyCH4III ACNGT 2 cut(s) 205, 613
HpyCH4V TGCA 2 cut(s) 227, 698
HpyF10VI GCNNNNNNNGC 3 cut(s) 284, 336, 494
HpyF3I CTNAG 4 cut(s) 446, 489, 533, 673
Hsp92II CATG 4 cut(s) 70, 130, 402, 592
KpnI GGTACC 1 cut(s) 50
Ksp22I TGATCA 1 cut(s) 63
Kzo9I GATC 2 cut(s) 63, 618
LmnI GCTCC 2 cut(s) 275, 458
MaeIII GTNAC 3 cut(s) 199, 522, 604
MalI GATC 2 cut(s) 65, 620
MbiI CCGCTC 1 cut(s) 497
MboI GATC 2 cut(s) 63, 618
MboII GAAGA 3 cut(s) 76, 164, 298
MhlI GDGCHC 2 cut(s) 541, 588
MluCI AATT 6 cut(s) 72, 168, 301, 515, 556, 705
MmeI TCCRAC 1 cut(s) 142
MnlI CCTC 9 cut(s) 16, 92, 98, 101, 113, 123, 380, 636, 682
MseI TTAA 4 cut(s) 9, 254, 555, 704
MslI CAYNNNNRTG 1 cut(s) 125
MspA1I CMGCKG 2 cut(s) 197, 677
MspR9I CCNGG 3 cut(s) 389, 418, 456
MvaI CCWGG 3 cut(s) 389, 418, 456
MwoI GCNNNNNNNGC 3 cut(s) 284, 336, 494
NcoI CCATGG 1 cut(s) 126
NdeII GATC 2 cut(s) 63, 618
NlaIII CATG 4 cut(s) 70, 130, 402, 592
NlaIV GGNNCC 2 cut(s) 48, 422
NmuCI GTSAC 3 cut(s) 199, 522, 604
PfoI TCCNGGA 1 cut(s) 454
PshBI ATTAAT 1 cut(s) 704
Psp6I CCWGG 3 cut(s) 387, 416, 454
PspGI CCWGG 3 cut(s) 387, 416, 454
PspN4I GGNNCC 2 cut(s) 48, 422
PspPI GGNCC 1 cut(s) 578
PvuII CAGCTG 2 cut(s) 197, 677
RsaI GTAC 3 cut(s) 48, 101, 362
RsaNI GTAC 3 cut(s) 47, 100, 361
RseI CAYNNNNRTG 1 cut(s) 125
SaqAI TTAA 4 cut(s) 9, 254, 555, 704
Sau3AI GATC 2 cut(s) 63, 618
Sau96I GGNCC 1 cut(s) 578
ScrFI CCNGG 3 cut(s) 389, 418, 456
SduI GDGCHC 2 cut(s) 541, 588
SfcI CTRYAG 1 cut(s) 192
SinI GGWCC 1 cut(s) 578
SmiMI CAYNNNNRTG 1 cut(s) 125
Sse9I AATT 6 cut(s) 72, 168, 301, 515, 556, 705
SsiI CCGC 1 cut(s) 497
StyD4I CCNGG 3 cut(s) 387, 416, 454
StyI CCWWGG 1 cut(s) 126
TaaI ACNGT 2 cut(s) 205, 613
TasI AATT 6 cut(s) 72, 168, 301, 515, 556, 705
TatI WGTACW 1 cut(s) 360
Tru1I TTAA 4 cut(s) 9, 254, 555, 704
Tru9I TTAA 4 cut(s) 9, 254, 555, 704
TscAI CASTG 2 cut(s) 208, 531
TseFI GTSAC 3 cut(s) 199, 522, 604
Tsp45I GTSAC 3 cut(s) 199, 522, 604
TspDTI ATGAA 3 cut(s) 150, 387, 705
TspRI CASTG 2 cut(s) 208, 531
VpaK11BI GGWCC 1 cut(s) 578
VspI ATTAAT 1 cut(s) 704
XapI RAATTY 2 cut(s) 168, 515
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.