MD07G1299400.v1.1

Ring finger domain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
35850869 .. 35851099
231 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1299400.v1.1.491

Sequence Viewer

Length: 231 bp
ATGGATAGCATGGAGGAAGGCCAAGTGGTGAGAGAGCCATGCAATTGTTCACATGCTTTTCATAAGGAGTGCCTAGATGTCTGGATTGATCAAGGTCAGCTAACATGTCCTCTCTGTAGATCAGAGCTATTGCCTAAAACTTGTAGTACTTCCCCAAACTCAAAAGATAAGGATCCATGGAGGAAGGAGAGGATGATTTACTTGTTTGGTGATGATTACTTCATGAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.88

Weight (kDa)

4.97

Isoelectric Point (pI)

51.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-C3HC4_2 PF13923 1 - 39 4.1e-06 Zinc finger, C3HC4 type (RING finger)
zf-RING_2 PF13639 2 - 40 4.1e-09 Ring finger domain
zf-rbx1 PF12678 14 - 40 7.7e-09 RING-H2 zinc finger domain
zf-C3HC4 PF00097 14 - 39 1.9e-06 Zinc finger, C3HC4 type (RING finger)
zf-ANAPC11 PF12861 15 - 43 9.3e-06 Anaphase-promoting complex subunit 11 RING-H2 finger
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 167, 180
AfaI GTAC 1 cut(s) 148
AflIII ACRYGT 1 cut(s) 104
AluBI AGCT 3 cut(s) 100, 127, 228
AluI AGCT 3 cut(s) 100, 127, 228
AlwI GGATC 2 cut(s) 167, 180
AoxI GGCC 1 cut(s) 19
AsuHPI GGTGA 2 cut(s) 40, 221
BamHI GGATCC 1 cut(s) 172
BclI TGATCA 1 cut(s) 88
BfaI CTAG 2 cut(s) 74, 229
BfmI CTRYAG 1 cut(s) 115
BmcAI AGTACT 1 cut(s) 148
BmiI GGNNCC 1 cut(s) 174
BsaBI GATNNNNATC 1 cut(s) 171
BsaJI CCNNGG 1 cut(s) 176
Bse8I GATNNNNATC 1 cut(s) 171
BseDI CCNNGG 1 cut(s) 176
BseGI GGATG 1 cut(s) 198
BseJI GATNNNNATC 1 cut(s) 171
BshFI GGCC 1 cut(s) 21
BsnI GGCC 1 cut(s) 21
Bsp143I GATC 3 cut(s) 88, 119, 172
Bsp19I CCATGG 1 cut(s) 176
BspANI GGCC 1 cut(s) 21
BspHI TCATGA 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 174
BspPI GGATC 2 cut(s) 167, 180
BssECI CCNNGG 1 cut(s) 176
BssMI GATC 3 cut(s) 88, 119, 172
BssT1I CCWWGG 1 cut(s) 176
BstDSI CCRYGG 1 cut(s) 176
BstF5I GGATG 1 cut(s) 198
BstKTI GATC 3 cut(s) 91, 122, 175
BstMBI GATC 3 cut(s) 88, 119, 172
BstNSI RCATGY 2 cut(s) 56, 108
BstSFI CTRYAG 1 cut(s) 115
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
BsuRI GGCC 1 cut(s) 21
BtgI CCRYGG 1 cut(s) 176
BtsCI GGATG 1 cut(s) 198
CciI TCATGA 1 cut(s) 222
Csp6I GTAC 1 cut(s) 147
CviAII CATG 6 cut(s) 10, 39, 53, 105, 177, 223
CviJI RGCY 5 cut(s) 21, 37, 100, 127, 228
CviKI_1 RGCY 5 cut(s) 21, 37, 100, 127, 228
CviQI GTAC 1 cut(s) 147
DpnI GATC 3 cut(s) 90, 121, 174
DpnII GATC 3 cut(s) 88, 119, 172
Eco130I CCWWGG 1 cut(s) 176
EcoT14I CCWWGG 1 cut(s) 176
ErhI CCWWGG 1 cut(s) 176
FaeI CATG 6 cut(s) 13, 42, 56, 108, 180, 226
FaiI YATR 7 cut(s) 11, 40, 54, 63, 106, 178, 224
FatI CATG 6 cut(s) 9, 38, 52, 104, 176, 222
FbaI TGATCA 1 cut(s) 88
FokI GGATG 1 cut(s) 205
FspBI CTAG 2 cut(s) 74, 229
HaeIII GGCC 1 cut(s) 21
Hin1II CATG 6 cut(s) 13, 42, 56, 108, 180, 226
HphI GGTGA 2 cut(s) 40, 221
Hpy166II GTNNAC 1 cut(s) 50
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 2 cut(s) 82, 223
Hpy8I GTNNAC 1 cut(s) 50
HpyAV CCTTC 2 cut(s) 11, 178
HpyCH4V TGCA 1 cut(s) 42
Hsp92II CATG 6 cut(s) 13, 42, 56, 108, 180, 226
Ksp22I TGATCA 1 cut(s) 88
Kzo9I GATC 3 cut(s) 88, 119, 172
LpnPI CCDG 1 cut(s) 67
MaeI CTAG 2 cut(s) 74, 229
MalI GATC 3 cut(s) 90, 121, 174
MboI GATC 3 cut(s) 88, 119, 172
MfeI CAATTG 1 cut(s) 43
MflI RGATCY 1 cut(s) 172
MluCI AATT 1 cut(s) 43
MnlI CCTC 4 cut(s) 7, 120, 174, 183
MunI CAATTG 1 cut(s) 43
NcoI CCATGG 1 cut(s) 176
NdeII GATC 3 cut(s) 88, 119, 172
NlaIII CATG 6 cut(s) 13, 42, 56, 108, 180, 226
NlaIV GGNNCC 1 cut(s) 174
NspI RCATGY 2 cut(s) 56, 108
PagI TCATGA 1 cut(s) 222
PciI ACATGT 1 cut(s) 104
PscI ACATGT 1 cut(s) 104
PspN4I GGNNCC 1 cut(s) 174
PsuI RGATCY 1 cut(s) 172
RsaI GTAC 1 cut(s) 148
RsaNI GTAC 1 cut(s) 147
Sau3AI GATC 3 cut(s) 88, 119, 172
ScaI AGTACT 1 cut(s) 148
SetI ASST 4 cut(s) 97, 102, 129, 230
SfcI CTRYAG 1 cut(s) 115
Sse9I AATT 1 cut(s) 43
SspMI CTAG 2 cut(s) 74, 229
StyI CCWWGG 1 cut(s) 176
TasI AATT 1 cut(s) 43
TatI WGTACW 1 cut(s) 146
TspDTI ATGAA 2 cut(s) 50, 211
XceI RCATGY 2 cut(s) 56, 108
XspI CTAG 2 cut(s) 74, 229
ZrmI AGTACT 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.