Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr1C

Orthogroup ID

OG0004548

Physical Location & Seq

Genomic Coordinates Reverse (-)

68920591 .. 68921181

Gene Structure 591 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh1CG433400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 591 bp

ATGAAGTTGATGTTGTTGCTGTGTGATCTTCTCAAACTTCTGCTCGAGAAGATCATCTACTATCCAGAATCATTCCTTAGACACAGTGAAGATGATCAACAAAGTAAGGACGATAGTGATCATCAGCTGGAGGTCATGAACTTTGAAGCTGCAGCAACTTCAGATCCTACTTGGTTGCACATGCAAGTACCAGTGGTTCCGGTGGTAAATATTGACACAGAATTCATTAAGAAGCAACTACCGGTTGTGCTATACCGGGACCTAATTCTGAAGAAAACAAGCCGCCAACGCCAATTTCAAGCTACATCATCATCTTCGGATCAGGAAATGCACATGTCATCATGTATTGTGTGCATGAATAGCATGGAGGGCATGGACGAGGTGAGAGAGCTGTGCAATTGTGAGCATGTTTTCCACAGAGACTGCCTGGATGCTTGGATCGGTCAGCCTCAGCTAAATTGTCCTCTTTGTAGATCTGAGCTATTAATACCAGCTCCAACTTCAAAGCATGATAAAGATGGAGGAAGAGATCTATGGAGGGCCGAGAGGATGATTTACTTGTTTGGTGAAGATATTTTCTTCAATATCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-RING_2

Protein Analysis

196

Amino Acids

22.83

Weight (kDa)

5.01

Isoelectric Point (pI)

55.68

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
zf-rbx1	PF12678	111 - 158	2e-07	RING-H2 zinc finger domain
zf-RING_2	PF13639	114 - 158	4.8e-10	Ring finger domain
zf-C3HC4_2	PF13923	115 - 157	7.8e-06	Zinc finger, C3HC4 type (RING finger)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004548)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g32950 FvH4_7g32960
malus_domestica	MD01G1228600.v1.1 MD07G1299400.v1.1 MD07G1299500.v1.1 MD07G1299600.v1.1
prunus_persica	Prupe.2G319200_v2.0.a1 Prupe.2G319300_v2.0.a1 Prupe.2G319400_v2.0.a1
pyrus_communis	pycom07g27170
rosa_chinensis	RchiOBHm_Chr1g0382911 RchiOBHm_Chr1g0382921
rosa_laevigata	RLG00000026149
rosa_multiflora	Rmu_co8270753.1_g000001 Rmu_co8320179.1_g000001 Rmu_sc0001785.1_g000002 Rmu_sc0010366.1_g000003
rosa_roxburghii	Rroxscaffold_4G00277780
rosa_samantha	Rh1AG462300 Rh1AG462400 Rh1AG462500 Rh1AG462600 Rh1BG419300 Rh1BG419400 Rh1CG433000 Rh1CG433100 Rh1CG433200 Rh1CG433400 Rh1DG451400 Rh1DG451500
rosa_wichuraiana	Rw1G040940 Rw1G040950

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	283
AclWI	GGATC	3 cut(s)	158, 327, 446
AcsI	RAATTY	1 cut(s)	221
AcuI	CTGAAG	2 cut(s)	144, 290
AfaI	GTAC	1 cut(s)	189
AflIII	ACRYGT	1 cut(s)	333
AgeI	ACCGGT	1 cut(s)	241
AgsI	TTSAA	4 cut(s)	146, 299, 504, 583
AjnI	CCWGG	1 cut(s)	426
AjuI	GAANNNNNNNTTGG	2 cut(s)	279, 311
AluBI	AGCT	7 cut(s)	127, 149, 302, 391, 454, 481, 494
AluI	AGCT	7 cut(s)	127, 149, 302, 391, 454, 481, 494
Alw26I	GTCTC	1 cut(s)	414
AlwI	GGATC	3 cut(s)	158, 327, 446
AlwNI	CAGNNNCTG	1 cut(s)	423
Ama87I	CYCGRG	1 cut(s)	44
AoxI	GGCC	1 cut(s)	540
ApeKI	GCWGC	2 cut(s)	149, 152
ApoI	RAATTY	1 cut(s)	221
AseI	ATTAAT	1 cut(s)	485
AsiGI	ACCGGT	1 cut(s)	241
AspS9I	GGNCC	2 cut(s)	259, 540
AsuC2I	CCSGG	1 cut(s)	257
AsuHPI	GGTGA	2 cut(s)	394, 578
AvaI	CYCGRG	1 cut(s)	44
AvaII	GGWCC	1 cut(s)	259
BarI	GAAGNNNNNNTAC	2 cut(s)	41, 73
BbvCI	CCTCAGC	1 cut(s)	450
BbvI	GCAGC	2 cut(s)	136, 164
BccI	CCATC	1 cut(s)	512
BciT130I	CCWGG	1 cut(s)	428
BclI	TGATCA	2 cut(s)	94, 118
BcnI	CCSGG	1 cut(s)	257
BcoDI	GTCTC	1 cut(s)	414
BfaI	CTAG	1 cut(s)	589
BfmI	CTRYAG	1 cut(s)	150
BglII	AGATCT	2 cut(s)	473, 529
BisI	GCNGC	3 cut(s)	150, 153, 283
BlsI	GCNGC	3 cut(s)	151, 154, 284
Bme1390I	CCNGG	2 cut(s)	257, 428
Bme18I	GGWCC	1 cut(s)	259
BmeT110I	CYCGRG	1 cut(s)	44
BmgT120I	GGNCC	2 cut(s)	259, 540
BmiI	GGNNCC	2 cut(s)	198, 260
BmrFI	CCNGG	2 cut(s)	257, 428
BmsI	GCATC	1 cut(s)	421
BpmI	CTGGAG	1 cut(s)	149
Bpu10I	CCTNAGC	1 cut(s)	450
BpuMI	CCSGG	1 cut(s)	257
BsaBI	GATNNNNATC	1 cut(s)	117
BsaWI	WCCGGW	2 cut(s)	199, 241
Bse118I	RCCGGY	1 cut(s)	241
Bse1I	ACTGG	1 cut(s)	191
Bse8I	GATNNNNATC	1 cut(s)	117
BseBI	CCWGG	1 cut(s)	428
BseGI	GGATG	2 cut(s)	436, 555
BseJI	GATNNNNATC	1 cut(s)	117
BseMII	CTCAG	2 cut(s)	464, 468
BseNI	ACTGG	1 cut(s)	191
BseXI	GCAGC	2 cut(s)	136, 164
BshFI	GGCC	1 cut(s)	542
BshTI	ACCGGT	1 cut(s)	241
BsiHKCI	CYCGRG	1 cut(s)	44
BsiSI	CCGG	3 cut(s)	200, 242, 256
BslFI	GGGAC	1 cut(s)	272
BsmAI	GTCTC	1 cut(s)	414
BsmFI	GGGAC	1 cut(s)	272
BsnI	GGCC	1 cut(s)	542
BsoBI	CYCGRG	1 cut(s)	44
Bsp143I	GATC	9 cut(s)	25, 51, 94, 118, 163, 319, 438, 473, 529
BspACI	CCGC	1 cut(s)	283
BspANI	GGCC	1 cut(s)	542
BspCNI	CTCAG	2 cut(s)	463, 469
BspHI	TCATGA	1 cut(s)	135
BspLI	GGNNCC	2 cut(s)	198, 260
BspMAI	CTGCAG	1 cut(s)	154
BspPI	GGATC	3 cut(s)	158, 327, 446
BsrFI	RCCGGY	1 cut(s)	241
BsrI	ACTGG	1 cut(s)	191
BssAI	RCCGGY	1 cut(s)	241
BssMI	GATC	9 cut(s)	25, 51, 94, 118, 163, 319, 438, 473, 529
Bst2UI	CCWGG	1 cut(s)	428
Bst4CI	ACNGT	1 cut(s)	86
Bst6I	CTCTTC	1 cut(s)	520
BstDEI	CTNAG	3 cut(s)	77, 450, 477
BstF5I	GGATG	2 cut(s)	436, 555
BstKTI	GATC	9 cut(s)	28, 54, 97, 121, 166, 322, 441, 476, 532
BstMAI	GTCTC	1 cut(s)	414
BstMBI	GATC	9 cut(s)	25, 51, 94, 118, 163, 319, 438, 473, 529
BstMWI	GCNNNNNNNGC	3 cut(s)	288, 360, 369
BstNI	CCWGG	1 cut(s)	428
BstNSI	RCATGY	3 cut(s)	184, 337, 410
BstSCI	CCNGG	2 cut(s)	255, 426
BstSFI	CTRYAG	1 cut(s)	150
BstV1I	GCAGC	2 cut(s)	136, 164
BstX2I	RGATCY	3 cut(s)	163, 473, 529
BstYI	RGATCY	3 cut(s)	163, 473, 529
BsuRI	GGCC	1 cut(s)	542
BtsCI	GGATG	2 cut(s)	436, 555
BtsIMutI	CAGTG	2 cut(s)	91, 198
CaiI	CAGNNNCTG	1 cut(s)	423
CciI	TCATGA	1 cut(s)	135
Cfr10I	RCCGGY	1 cut(s)	241
Cfr13I	GGNCC	2 cut(s)	259, 540
Csp6I	GTAC	1 cut(s)	188
CspAI	ACCGGT	1 cut(s)	241
CviAII	CATG	9 cut(s)	136, 181, 334, 342, 355, 364, 373, 407, 509
CviQI	GTAC	1 cut(s)	188
DdeI	CTNAG	3 cut(s)	77, 450, 477
DpnI	GATC	9 cut(s)	27, 53, 96, 120, 165, 321, 440, 475, 531
DpnII	GATC	9 cut(s)	25, 51, 94, 118, 163, 319, 438, 473, 529
Eam1104I	CTCTTC	1 cut(s)	520
EarI	CTCTTC	1 cut(s)	520
Eco47I	GGWCC	1 cut(s)	259
Eco57I	CTGAAG	2 cut(s)	144, 290
Eco88I	CYCGRG	1 cut(s)	44
EcoO109I	RGGNCCY	1 cut(s)	259
EcoRI	GAATTC	1 cut(s)	221
EcoRII	CCWGG	1 cut(s)	426
FaeI	CATG	9 cut(s)	139, 184, 337, 345, 358, 367, 376, 410, 512
FaqI	GGGAC	1 cut(s)	272
FatI	CATG	9 cut(s)	135, 180, 333, 341, 354, 363, 372, 406, 508
FbaI	TGATCA	2 cut(s)	94, 118
Fnu4HI	GCNGC	3 cut(s)	150, 153, 283
FokI	GGATG	2 cut(s)	443, 562
Fsp4HI	GCNGC	3 cut(s)	150, 153, 283
FspBI	CTAG	1 cut(s)	589
GluI	GCNGC	3 cut(s)	150, 153, 283
GsuI	CTGGAG	1 cut(s)	149
HaeIII	GGCC	1 cut(s)	542
HapII	CCGG	3 cut(s)	200, 242, 256
Hin1II	CATG	9 cut(s)	139, 184, 337, 345, 358, 367, 376, 410, 512
HinfI	GANTC	1 cut(s)	68
HpaII	CCGG	3 cut(s)	200, 242, 256
HphI	GGTGA	2 cut(s)	394, 578
Hpy188I	TCNGA	4 cut(s)	163, 270, 319, 478
Hpy188III	TCNNGA	4 cut(s)	46, 65, 136, 323
HpyCH4III	ACNGT	1 cut(s)	86
HpyCH4V	TGCA	6 cut(s)	152, 178, 184, 331, 354, 396
HpyF10VI	GCNNNNNNNGC	3 cut(s)	288, 360, 369
HpyF3I	CTNAG	3 cut(s)	77, 450, 477
Hsp92II	CATG	9 cut(s)	139, 184, 337, 345, 358, 367, 376, 410, 512
Ksp22I	TGATCA	2 cut(s)	94, 118
Kzo9I	GATC	9 cut(s)	25, 51, 94, 118, 163, 319, 438, 473, 529
LmnI	GCTCC	1 cut(s)	499
Lsp1109I	GCAGC	2 cut(s)	136, 164
LweI	GCATC	1 cut(s)	421
MaeI	CTAG	1 cut(s)	589
MalI	GATC	9 cut(s)	27, 53, 96, 120, 165, 321, 440, 475, 531
MboI	GATC	9 cut(s)	25, 51, 94, 118, 163, 319, 438, 473, 529
MboII	GAAGA	8 cut(s)	20, 61, 101, 283, 306, 537, 571, 581
MfeI	CAATTG	1 cut(s)	397
MflI	RGATCY	3 cut(s)	163, 473, 529
MluCI	AATT	5 cut(s)	221, 264, 293, 397, 457
MmeI	TCCRAC	1 cut(s)	521
MnlI	CCTC	8 cut(s)	124, 361, 373, 459, 474, 515, 531, 540
MseI	TTAA	2 cut(s)	228, 485
MspA1I	CMGCKG	1 cut(s)	127
MspI	CCGG	3 cut(s)	200, 242, 256
MspR9I	CCNGG	2 cut(s)	257, 428
MunI	CAATTG	1 cut(s)	397
MvaI	CCWGG	1 cut(s)	428
MwoI	GCNNNNNNNGC	3 cut(s)	288, 360, 369
NciI	CCSGG	1 cut(s)	257
NdeII	GATC	9 cut(s)	25, 51, 94, 118, 163, 319, 438, 473, 529
NlaIII	CATG	9 cut(s)	139, 184, 337, 345, 358, 367, 376, 410, 512
NlaIV	GGNNCC	2 cut(s)	198, 260
NmeAIII	GCCGAG	1 cut(s)	568
NspI	RCATGY	3 cut(s)	184, 337, 410
PaeR7I	CTCGAG	1 cut(s)	44
PagI	TCATGA	1 cut(s)	135
PciI	ACATGT	1 cut(s)	333
PfeI	GAWTC	1 cut(s)	68
PinAI	ACCGGT	1 cut(s)	241
PkrI	GCNGC	3 cut(s)	151, 154, 284
PpuMI	RGGWCCY	1 cut(s)	259
PscI	ACATGT	1 cut(s)	333
PshBI	ATTAAT	1 cut(s)	485
Psp5II	RGGWCCY	1 cut(s)	259
Psp6I	CCWGG	1 cut(s)	426
PspGI	CCWGG	1 cut(s)	426
PspN4I	GGNNCC	2 cut(s)	198, 260
PspPI	GGNCC	2 cut(s)	259, 540
PspPPI	RGGWCCY	1 cut(s)	259
PsrI	GAACNNNNNNTAC	2 cut(s)	180, 212
PstI	CTGCAG	1 cut(s)	154
PstNI	CAGNNNCTG	1 cut(s)	423
PsuI	RGATCY	3 cut(s)	163, 473, 529
PvuII	CAGCTG	1 cut(s)	127
RsaI	GTAC	1 cut(s)	189
RsaNI	GTAC	1 cut(s)	188
SaqAI	TTAA	2 cut(s)	228, 485
SatI	GCNGC	3 cut(s)	150, 153, 283
Sau3AI	GATC	9 cut(s)	25, 51, 94, 118, 163, 319, 438, 473, 529
Sau96I	GGNCC	2 cut(s)	259, 540
ScrFI	CCNGG	2 cut(s)	257, 428
SfaNI	GCATC	1 cut(s)	421
SfcI	CTRYAG	1 cut(s)	150
Sfr274I	CTCGAG	1 cut(s)	44
SinI	GGWCC	1 cut(s)	259
SlaI	CTCGAG	1 cut(s)	44
SmlI	CTYRAG	1 cut(s)	44
SmoI	CTYRAG	1 cut(s)	44
Sse9I	AATT	5 cut(s)	221, 264, 293, 397, 457
SsiI	CCGC	1 cut(s)	283
SspI	AATATT	1 cut(s)	211
SspMI	CTAG	1 cut(s)	589
StyD4I	CCNGG	2 cut(s)	255, 426
TaaI	ACNGT	1 cut(s)	86
TaqI	TCGA	1 cut(s)	45
TaqII	GACCGA	1 cut(s)	431
TasI	AATT	5 cut(s)	221, 264, 293, 397, 457
TauI	GCSGC	1 cut(s)	285
TfiI	GAWTC	1 cut(s)	68
Tru1I	TTAA	2 cut(s)	228, 485
Tru9I	TTAA	2 cut(s)	228, 485
TscAI	CASTG	2 cut(s)	91, 198
TseI	GCWGC	2 cut(s)	149, 152
TspDTI	ATGAA	4 cut(s)	17, 152, 214, 371
TspRI	CASTG	2 cut(s)	91, 198
VpaK11BI	GGWCC	1 cut(s)	259
VspI	ATTAAT	1 cut(s)	485
XapI	RAATTY	1 cut(s)	221
XceI	RCATGY	3 cut(s)	184, 337, 410
XhoI	CTCGAG	1 cut(s)	44
XspI	CTAG	1 cut(s)	589

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.