Rh1CG433000

Ring finger domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
68898348 .. 68898569
222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG433000.1

Sequence Viewer

Length: 222 bp
ATGGATGGAGTAAGAGAGCTGAAGAACTGTTCCCACGTCTTTCATAGAGAGTGCTTGGATCTTTGGGTTGCTGAGGGTCAGTTAACCTGTCCTCTGTTCAGGTCTAAGCTATTGCCAACTGCTACGGCTACTCCAAATGAACATTGGAAACCTGAAGGAGGGGATCCATGGAGATCGGAGAGGATGATTTACTTGTTCGGTGATGATTACGTCTTCCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.54

Weight (kDa)

5.46

Isoelectric Point (pI)

39.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-RING_2 PF13639 8 - 32 3.2e-06 Ring finger domain
zf-rbx1 PF12678 9 - 32 1.3e-06 RING-H2 zinc finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 66, 158, 171
AcuI CTGAAG 2 cut(s) 41, 174
AfiI CCNNNNNNNGG 1 cut(s) 158
AjiI CACGTC 1 cut(s) 37
AluBI AGCT 2 cut(s) 19, 109
AluI AGCT 2 cut(s) 19, 109
AlwI GGATC 3 cut(s) 66, 158, 171
AsuHPI GGTGA 1 cut(s) 212
BamHI GGATCC 1 cut(s) 163
BbsI GAAGAC 1 cut(s) 205
BbvCI CCTCAGC 1 cut(s) 72
BceAI ACGGC 1 cut(s) 141
BmgBI CACGTC 1 cut(s) 37
BmiI GGNNCC 1 cut(s) 165
BpiI GAAGAC 1 cut(s) 205
Bpu10I CCTNAGC 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 167
BsaXI ACNNNNNCTCC 2 cut(s) 115, 145
Bsc4I CCNNNNNNNGG 1 cut(s) 158
Bse1I ACTGG 1 cut(s) 217
BseDI CCNNGG 1 cut(s) 167
BseGI GGATG 2 cut(s) 10, 189
BseLI CCNNNNNNNGG 1 cut(s) 158
BseMII CTCAG 1 cut(s) 63
BseNI ACTGG 1 cut(s) 217
BslI CCNNNNNNNGG 1 cut(s) 158
Bsp143I GATC 3 cut(s) 58, 163, 173
Bsp19I CCATGG 1 cut(s) 167
BspCNI CTCAG 1 cut(s) 64
BspLI GGNNCC 1 cut(s) 165
BspPI GGATC 3 cut(s) 66, 158, 171
BsrI ACTGG 1 cut(s) 217
BssECI CCNNGG 1 cut(s) 167
BssMI GATC 3 cut(s) 58, 163, 173
BssT1I CCWWGG 1 cut(s) 167
Bst4CI ACNGT 1 cut(s) 29
BstDEI CTNAG 2 cut(s) 72, 105
BstDSI CCRYGG 1 cut(s) 167
BstENI CCTNNNNNAGG 1 cut(s) 156
BstF5I GGATG 2 cut(s) 10, 189
BstKTI GATC 3 cut(s) 61, 166, 176
BstMBI GATC 3 cut(s) 58, 163, 173
BstV2I GAAGAC 1 cut(s) 205
BstX2I RGATCY 2 cut(s) 58, 163
BstYI RGATCY 2 cut(s) 58, 163
BtgI CCRYGG 1 cut(s) 167
BtrI CACGTC 1 cut(s) 37
BtsCI GGATG 2 cut(s) 10, 189
CviAII CATG 1 cut(s) 168
CviJI RGCY 3 cut(s) 19, 109, 128
CviKI_1 RGCY 3 cut(s) 19, 109, 128
DdeI CTNAG 2 cut(s) 72, 105
DpnI GATC 3 cut(s) 60, 165, 175
DpnII GATC 3 cut(s) 58, 163, 173
Eco130I CCWWGG 1 cut(s) 167
Eco57I CTGAAG 2 cut(s) 41, 174
EcoNI CCTNNNNNAGG 1 cut(s) 156
EcoT14I CCWWGG 1 cut(s) 167
ErhI CCWWGG 1 cut(s) 167
FaeI CATG 1 cut(s) 171
FaiI YATR 2 cut(s) 45, 169
FatI CATG 1 cut(s) 167
FokI GGATG 2 cut(s) 17, 196
Hin1II CATG 1 cut(s) 171
HincII GTYRAC 1 cut(s) 84
HindII GTYRAC 1 cut(s) 84
HpaI GTTAAC 1 cut(s) 84
HphI GGTGA 1 cut(s) 212
Hpy166II GTNNAC 1 cut(s) 84
Hpy188I TCNGA 1 cut(s) 178
Hpy8I GTNNAC 1 cut(s) 84
HpyAV CCTTC 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 29
HpyCH4IV ACGT 2 cut(s) 36, 210
HpyF3I CTNAG 2 cut(s) 72, 105
HpySE526I ACGT 2 cut(s) 36, 210
Hsp92II CATG 1 cut(s) 171
KspAI GTTAAC 1 cut(s) 84
Kzo9I GATC 3 cut(s) 58, 163, 173
LpnPI CCDG 3 cut(s) 85, 100, 165
MaeII ACGT 2 cut(s) 36, 210
MalI GATC 3 cut(s) 60, 165, 175
MboI GATC 3 cut(s) 58, 163, 173
MboII GAAGA 2 cut(s) 34, 205
MflI RGATCY 2 cut(s) 58, 163
MnlI CCTC 4 cut(s) 67, 102, 152, 174
MseI TTAA 1 cut(s) 83
NcoI CCATGG 1 cut(s) 167
NdeII GATC 3 cut(s) 58, 163, 173
NlaIII CATG 1 cut(s) 171
NlaIV GGNNCC 1 cut(s) 165
PspN4I GGNNCC 1 cut(s) 165
PsuI RGATCY 2 cut(s) 58, 163
SaqAI TTAA 1 cut(s) 83
Sau3AI GATC 3 cut(s) 58, 163, 173
SetI ASST 7 cut(s) 21, 39, 89, 104, 111, 154, 213
SgeI CNNG 7 cut(s) 47, 67, 99, 112, 164, 180, 205
StyI CCWWGG 1 cut(s) 167
TaaI ACNGT 1 cut(s) 29
TaiI ACGT 2 cut(s) 39, 213
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TspDTI ATGAA 2 cut(s) 32, 153
XagI CCTNNNNNAGG 1 cut(s) 156
XcmI CCANNNNNNNNNTGG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.