MD12G1085400.v1.1

Belongs to the leguminous lectin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0001977
Physical Location & Seq
Reverse (-)
10479744 .. 10480100
357 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1085400.v1.1.491

Sequence Viewer

Length: 357 bp
ATGTCTTTATCAACAAACTTCTCGTTTTCTATTTCCAACGGTGGTGGGGATGGATTGGTGTTTGTAATGATTCCAAAGGGTTTTAATCATAGCTTATTTGGTAACAGCTCTTTTAGGCTTTCTTTAGGAAATGGTAAAAGTAAATTCAAAGTTGTTGCAATTAAATTTGATGCATTGAGTGATGGAAATGTTCATGTTGGAATTGAAGTGGGTGGTTCTATTTCTGCTAAGAATTTGGATCCAACTAGTGGGAATAAAACGCAGGCTTGGATCGATTACGAAGCGGGTTCGAATCAAATTGAAGTTAGGCTGAGTAAATTTGGTGGGTGTGCAGAAGAAAGGGGTTGGGAGAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lectin_legB

Protein Analysis

119

Amino Acids

12.51

Weight (kDa)

6.72

Isoelectric Point (pI)

18.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lectin_legB PF00139 2 - 108 2.6e-16 Legume lectin domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 248
AciI CCGC 1 cut(s) 284
AclWI GGATC 3 cut(s) 233, 246, 278
AcsI RAATTY 4 cut(s) 143, 164, 232, 317
AfiI CCNNNNNNNGG 1 cut(s) 248
AgsI TTSAA 3 cut(s) 148, 206, 302
AhlI ACTAGT 1 cut(s) 245
AluBI AGCT 2 cut(s) 93, 108
AluI AGCT 2 cut(s) 93, 108
AlwI GGATC 3 cut(s) 233, 246, 278
ApoI RAATTY 4 cut(s) 143, 164, 232, 317
AsuII TTCGAA 1 cut(s) 290
BamHI GGATCC 1 cut(s) 238
BccI CCATC 2 cut(s) 44, 176
BcuI ACTAGT 1 cut(s) 245
BfaI CTAG 1 cut(s) 246
BmiI GGNNCC 1 cut(s) 240
BmsI GCATC 1 cut(s) 160
Bpu14I TTCGAA 1 cut(s) 290
Bsa29I ATCGAT 1 cut(s) 273
Bsc4I CCNNNNNNNGG 1 cut(s) 248
BseCI ATCGAT 1 cut(s) 273
BseGI GGATG 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 248
BseMII CTCAG 1 cut(s) 302
BsgI GTGCAG 1 cut(s) 351
BshVI ATCGAT 1 cut(s) 273
BslI CCNNNNNNNGG 1 cut(s) 248
Bsp119I TTCGAA 1 cut(s) 290
Bsp143I GATC 2 cut(s) 238, 270
BspACI CCGC 1 cut(s) 284
BspCNI CTCAG 1 cut(s) 303
BspDI ATCGAT 1 cut(s) 273
BspLI GGNNCC 1 cut(s) 240
BspPI GGATC 3 cut(s) 233, 246, 278
BspT104I TTCGAA 1 cut(s) 290
BssMI GATC 2 cut(s) 238, 270
Bst4CI ACNGT 1 cut(s) 41
BstBI TTCGAA 1 cut(s) 290
BstC8I GCNNGC 1 cut(s) 264
BstDEI CTNAG 2 cut(s) 228, 311
BstF5I GGATG 1 cut(s) 55
BstKTI GATC 2 cut(s) 241, 273
BstMBI GATC 2 cut(s) 238, 270
BstX2I RGATCY 1 cut(s) 238
BstYI RGATCY 1 cut(s) 238
Bsu15I ATCGAT 1 cut(s) 273
BsuTUI ATCGAT 1 cut(s) 273
BtsCI GGATG 1 cut(s) 55
Cac8I GCNNGC 1 cut(s) 264
ClaI ATCGAT 1 cut(s) 273
CspCI CAANNNNNGTGG 2 cut(s) 25, 60
CviAII CATG 1 cut(s) 194
CviJI RGCY 5 cut(s) 93, 108, 118, 266, 310
CviKI_1 RGCY 5 cut(s) 93, 108, 118, 266, 310
DdeI CTNAG 2 cut(s) 228, 311
DpnI GATC 2 cut(s) 240, 272
DpnII GATC 2 cut(s) 238, 270
EcoT22I ATGCAT 1 cut(s) 175
FaeI CATG 1 cut(s) 197
FaiI YATR 2 cut(s) 90, 195
FatI CATG 1 cut(s) 193
FauI CCCGC 1 cut(s) 277
FokI GGATG 1 cut(s) 62
FspBI CTAG 1 cut(s) 246
Hin1II CATG 1 cut(s) 197
HinfI GANTC 2 cut(s) 70, 292
HpyCH4III ACNGT 1 cut(s) 41
HpyCH4V TGCA 3 cut(s) 158, 173, 332
HpyF3I CTNAG 2 cut(s) 228, 311
Hsp92II CATG 1 cut(s) 197
Kzo9I GATC 2 cut(s) 238, 270
LpnPI CCDG 1 cut(s) 248
LweI GCATC 1 cut(s) 160
MaeI CTAG 1 cut(s) 246
MaeIII GTNAC 1 cut(s) 101
MalI GATC 2 cut(s) 240, 272
MboI GATC 2 cut(s) 238, 270
MboII GAAGA 1 cut(s) 347
MflI RGATCY 1 cut(s) 238
MluCI AATT 7 cut(s) 143, 159, 164, 201, 232, 297, 317
MmeI TCCRAC 3 cut(s) 60, 178, 266
Mph1103I ATGCAT 1 cut(s) 175
MseI TTAA 2 cut(s) 84, 162
NdeII GATC 2 cut(s) 238, 270
NlaIII CATG 1 cut(s) 197
NlaIV GGNNCC 1 cut(s) 240
NsiI ATGCAT 1 cut(s) 175
NspV TTCGAA 1 cut(s) 290
PfeI GAWTC 2 cut(s) 70, 292
PflMI CCANNNNNTGG 1 cut(s) 248
PspN4I GGNNCC 1 cut(s) 240
PsuI RGATCY 1 cut(s) 238
SaqAI TTAA 2 cut(s) 84, 162
Sau3AI GATC 2 cut(s) 238, 270
SetI ASST 2 cut(s) 95, 110
SfaNI GCATC 1 cut(s) 160
SfuI TTCGAA 1 cut(s) 290
SgeI CNNG 6 cut(s) 34, 206, 258, 275, 279, 297
SpeI ACTAGT 1 cut(s) 245
Sse9I AATT 7 cut(s) 143, 159, 164, 201, 232, 297, 317
SsiI CCGC 1 cut(s) 284
SspMI CTAG 1 cut(s) 246
TaaI ACNGT 1 cut(s) 41
TaqI TCGA 2 cut(s) 273, 290
TasI AATT 7 cut(s) 143, 159, 164, 201, 232, 297, 317
TfiI GAWTC 2 cut(s) 70, 292
Tru1I TTAA 2 cut(s) 84, 162
Tru9I TTAA 2 cut(s) 84, 162
TspDTI ATGAA 1 cut(s) 182
Van91I CCANNNNNTGG 1 cut(s) 248
XapI RAATTY 4 cut(s) 143, 164, 232, 317
XspI CTAG 1 cut(s) 246
Zsp2I ATGCAT 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.