Rmu_sc0001552.1_g000037

Belongs to the leguminous lectin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001552.1
OG0001977
Physical Location & Seq
Forward (+)
94454 .. 94876
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001552.1_g000037.1.cds

Sequence Viewer

Length: 423 bp
atgtggaaagataaggatgtgtatgtagggataagctcgtcgaattcgaatggcagttcctcgcagatttgtagtgtgtattcttggagttttaggatgagaaaggttccgaggatgcattctcttccggtgaatccgaggggttatttggatgatcagcatggtgaaaatcggggtctgcataagaggatggcttgtccattgtcaattcttgctgggattatattcatgactgggtgtggagctctggtttcatttgtcatgctgtttttgtgggctgtaattgttaacaggcacacagttttccttgctgaagtgctcccagatgagtttccggtgaagcctaatcctacggatttcaggtatgagaagatcagtgtagttgtagaggaagatgcagatgcagatggtgttaagaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lectin_legB

Protein Analysis

140

Amino Acids

15.75

Weight (kDa)

7.75

Isoelectric Point (pI)

27.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 43
AcuI CTGAAG 1 cut(s) 333
AluBI AGCT 2 cut(s) 36, 245
AluI AGCT 2 cut(s) 36, 245
Alw21I GWGCWC 2 cut(s) 247, 321
ApoI RAATTY 1 cut(s) 43
AsuHPI GGTGA 3 cut(s) 142, 176, 349
AsuII TTCGAA 1 cut(s) 47
BanII GRGCYC 1 cut(s) 247
Bbv12I GWGCWC 2 cut(s) 247, 321
BccI CCATC 2 cut(s) 184, 401
BclI TGATCA 1 cut(s) 154
BmiI GGNNCC 1 cut(s) 108
BmrI ACTGGG 1 cut(s) 243
BmsI GCATC 3 cut(s) 105, 385, 391
BmuI ACTGGG 1 cut(s) 243
Bpu14I TTCGAA 1 cut(s) 47
BsaJI CCNNGG 2 cut(s) 110, 137
BsaWI WCCGGW 2 cut(s) 127, 334
BsaXI ACNNNNNCTCC 2 cut(s) 234, 264
Bse1I ACTGG 1 cut(s) 238
BseDI CCNNGG 2 cut(s) 110, 137
BseGI GGATG 5 cut(s) 22, 102, 120, 157, 195
BseNI ACTGG 1 cut(s) 238
BseYI CCCAGC 1 cut(s) 215
BsiHKAI GWGCWC 2 cut(s) 247, 321
BsiSI CCGG 2 cut(s) 128, 335
BsmI GAATGC 1 cut(s) 118
Bsp119I TTCGAA 1 cut(s) 47
Bsp1286I GDGCHC 2 cut(s) 247, 321
Bsp143I GATC 2 cut(s) 154, 372
BspHI TCATGA 1 cut(s) 228
BspLI GGNNCC 1 cut(s) 108
BspT104I TTCGAA 1 cut(s) 47
BsrI ACTGG 1 cut(s) 238
BssECI CCNNGG 2 cut(s) 110, 137
BssMI GATC 2 cut(s) 154, 372
Bst4CI ACNGT 1 cut(s) 301
Bst6I CTCTTC 1 cut(s) 129
BstBI TTCGAA 1 cut(s) 47
BstF5I GGATG 5 cut(s) 22, 102, 120, 157, 195
BstKTI GATC 2 cut(s) 157, 375
BstMBI GATC 2 cut(s) 154, 372
BtsCI GGATG 5 cut(s) 22, 102, 120, 157, 195
BtsIMutI CAGTG 1 cut(s) 382
CciI TCATGA 1 cut(s) 228
CviAII CATG 3 cut(s) 161, 229, 262
CviJI RGCY 5 cut(s) 36, 194, 245, 278, 343
CviKI_1 RGCY 5 cut(s) 36, 194, 245, 278, 343
DpnI GATC 2 cut(s) 156, 374
DpnII GATC 2 cut(s) 154, 372
Eam1104I CTCTTC 1 cut(s) 129
EarI CTCTTC 1 cut(s) 129
Ecl136II GAGCTC 1 cut(s) 245
Eco24I GRGCYC 1 cut(s) 247
Eco53kI GAGCTC 1 cut(s) 245
Eco57I CTGAAG 1 cut(s) 333
EcoICRI GAGCTC 1 cut(s) 245
EcoRI GAATTC 1 cut(s) 43
EcoT22I ATGCAT 1 cut(s) 120
EcoT38I GRGCYC 1 cut(s) 247
FaeI CATG 3 cut(s) 164, 232, 265
FaiI YATR 7 cut(s) 24, 162, 183, 224, 230, 263, 366
FatI CATG 3 cut(s) 160, 228, 261
FbaI TGATCA 1 cut(s) 154
FokI GGATG 5 cut(s) 29, 109, 127, 164, 202
FriOI GRGCYC 1 cut(s) 247
GsaI CCCAGC 1 cut(s) 219
HapII CCGG 2 cut(s) 128, 335
Hin1II CATG 3 cut(s) 164, 232, 265
HincII GTYRAC 1 cut(s) 289
HindII GTYRAC 1 cut(s) 289
HinfI GANTC 1 cut(s) 133
HpaI GTTAAC 1 cut(s) 289
HpaII CCGG 2 cut(s) 128, 335
HphI GGTGA 3 cut(s) 142, 176, 349
Hpy166II GTNNAC 1 cut(s) 289
Hpy188I TCNGA 2 cut(s) 111, 138
Hpy188III TCNNGA 1 cut(s) 229
Hpy8I GTNNAC 1 cut(s) 289
Hpy99I CGWCG 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 301
HpyCH4V TGCA 4 cut(s) 118, 181, 398, 404
Hsp92II CATG 3 cut(s) 164, 232, 265
Ksp22I TGATCA 1 cut(s) 154
KspAI GTTAAC 1 cut(s) 289
Kzo9I GATC 2 cut(s) 154, 372
LmnI GCTCC 2 cut(s) 242, 324
LpnPI CCDG 8 cut(s) 141, 201, 219, 233, 277, 336, 346, 348
LweI GCATC 3 cut(s) 105, 385, 391
MalI GATC 2 cut(s) 156, 374
MboI GATC 2 cut(s) 154, 372
MboII GAAGA 3 cut(s) 116, 382, 404
MhlI GDGCHC 2 cut(s) 247, 321
MluCI AATT 3 cut(s) 43, 207, 282
MnlI CCTC 5 cut(s) 70, 105, 132, 180, 382
Mph1103I ATGCAT 1 cut(s) 120
MseI TTAA 2 cut(s) 288, 414
MspI CCGG 2 cut(s) 128, 335
Mva1269I GAATGC 1 cut(s) 118
NdeII GATC 2 cut(s) 154, 372
NlaIII CATG 3 cut(s) 164, 232, 265
NlaIV GGNNCC 1 cut(s) 108
NsiI ATGCAT 1 cut(s) 120
NspV TTCGAA 1 cut(s) 47
PagI TCATGA 1 cut(s) 228
PcsI WCGNNNNNNNCGW 1 cut(s) 44
PctI GAATGC 1 cut(s) 118
PfeI GAWTC 1 cut(s) 133
Psp124BI GAGCTC 1 cut(s) 247
PspFI CCCAGC 1 cut(s) 215
PspN4I GGNNCC 1 cut(s) 108
SacI GAGCTC 1 cut(s) 247
SaqAI TTAA 2 cut(s) 288, 414
Sau3AI GATC 2 cut(s) 154, 372
SduI GDGCHC 2 cut(s) 247, 321
SetI ASST 4 cut(s) 38, 108, 247, 365
SfaNI GCATC 3 cut(s) 105, 385, 391
SfuI TTCGAA 1 cut(s) 47
Sse9I AATT 3 cut(s) 43, 207, 282
SstI GAGCTC 1 cut(s) 247
TaaI ACNGT 1 cut(s) 301
TaqI TCGA 2 cut(s) 41, 47
TasI AATT 3 cut(s) 43, 207, 282
TfiI GAWTC 1 cut(s) 133
Tru1I TTAA 2 cut(s) 288, 414
Tru9I TTAA 2 cut(s) 288, 414
TscAI CASTG 1 cut(s) 382
TspDTI ATGAA 2 cut(s) 217, 243
TspGWI ACGGA 1 cut(s) 368
TspRI CASTG 1 cut(s) 382
XapI RAATTY 1 cut(s) 43
Zsp2I ATGCAT 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.