MD13G1012200.v1.1

Belongs to the DEFL family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Reverse (-)
712407 .. 712565
159 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1012200.v1.1.491

Sequence Viewer

Length: 159 bp
ATGGTTGCAGAGGGTAGGACCTGCGAGTCTCAGAGTAACCCCTTCAAGGGGACTTGCGTGAGTAAAAGTAACTCTGTTGCTGTTTGCCAAATTGAGGGCTTCCCTGGAGGCCAGTGTTGTGGCCTATGCCGTAGATTCTTTTGCACTAGACATTGTTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.62

Weight (kDa)

8.51

Isoelectric Point (pI)

53.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Gamma-thionin PF00304 6 - 52 1e-11 Gamma-thionin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 25
Acc36I ACCTGC 1 cut(s) 29
AfiI CCNNNNNNNGG 4 cut(s) 46, 47, 48, 94
AgsI TTSAA 1 cut(s) 46
AjnI CCWGG 1 cut(s) 103
Alw26I GTCTC 1 cut(s) 33
AoxI GGCC 2 cut(s) 109, 121
AspS9I GGNCC 1 cut(s) 18
AvaII GGWCC 1 cut(s) 18
BceAI ACGGC 1 cut(s) 114
BciT130I CCWGG 1 cut(s) 105
BcoDI GTCTC 1 cut(s) 33
BfaI CTAG 1 cut(s) 147
BfuAI ACCTGC 1 cut(s) 29
Bme1390I CCNGG 1 cut(s) 105
Bme18I GGWCC 1 cut(s) 18
BmgT120I GGNCC 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 105
BpmI CTGGAG 1 cut(s) 126
BsaJI CCNNGG 1 cut(s) 103
Bsc4I CCNNNNNNNGG 4 cut(s) 46, 47, 48, 94
Bse1I ACTGG 1 cut(s) 112
BseBI CCWGG 1 cut(s) 105
BseDI CCNNGG 1 cut(s) 103
BseLI CCNNNNNNNGG 4 cut(s) 46, 47, 48, 94
BseMII CTCAG 1 cut(s) 44
BseNI ACTGG 1 cut(s) 112
BshFI GGCC 2 cut(s) 111, 123
BslFI GGGAC 1 cut(s) 64
BslI CCNNNNNNNGG 4 cut(s) 46, 47, 48, 94
BsmAI GTCTC 1 cut(s) 33
BsmFI GGGAC 1 cut(s) 64
BsnI GGCC 2 cut(s) 111, 123
BspANI GGCC 2 cut(s) 111, 123
BspCNI CTCAG 1 cut(s) 43
BspMI ACCTGC 1 cut(s) 29
BsrI ACTGG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 103
Bst2UI CCWGG 1 cut(s) 105
BstDEI CTNAG 1 cut(s) 30
BstMAI GTCTC 1 cut(s) 33
BstNI CCWGG 1 cut(s) 105
BstSCI CCNGG 1 cut(s) 103
BstXI CCANNNNNNTGG 1 cut(s) 119
BsuRI GGCC 2 cut(s) 111, 123
BtsIMutI CAGTG 1 cut(s) 119
BveI ACCTGC 1 cut(s) 29
Cfr13I GGNCC 1 cut(s) 18
CviJI RGCY 3 cut(s) 99, 111, 123
CviKI_1 RGCY 3 cut(s) 99, 111, 123
DdeI CTNAG 1 cut(s) 30
DrdI GACNNNNNNGTC 1 cut(s) 25
DseDI GACNNNNNNGTC 1 cut(s) 25
Eco47I GGWCC 1 cut(s) 18
EcoO109I RGGNCCY 1 cut(s) 18
EcoRII CCWGG 1 cut(s) 103
FaiI YATR 1 cut(s) 127
FaqI GGGAC 1 cut(s) 64
FspBI CTAG 1 cut(s) 147
GsuI CTGGAG 1 cut(s) 126
HaeIII GGCC 2 cut(s) 111, 123
HinfI GANTC 2 cut(s) 26, 135
Hpy188I TCNGA 1 cut(s) 33
HpyAV CCTTC 1 cut(s) 52
HpyCH4V TGCA 2 cut(s) 8, 144
HpyF3I CTNAG 1 cut(s) 30
LpnPI CCDG 4 cut(s) 34, 90, 117, 125
MaeI CTAG 1 cut(s) 147
MaeIII GTNAC 2 cut(s) 35, 68
MluCI AATT 1 cut(s) 90
MlyI GAGTC 1 cut(s) 35
MnlI CCTC 3 cut(s) 4, 88, 101
MseI TTAA 1 cut(s) 157
MspR9I CCNGG 1 cut(s) 105
MvaI CCWGG 1 cut(s) 105
PfeI GAWTC 1 cut(s) 135
PleI GAGTC 1 cut(s) 34
PpsI GAGTC 1 cut(s) 34
PpuMI RGGWCCY 1 cut(s) 18
Psp5II RGGWCCY 1 cut(s) 18
Psp6I CCWGG 1 cut(s) 103
PspGI CCWGG 1 cut(s) 103
PspPI GGNCC 1 cut(s) 18
PspPPI RGGWCCY 1 cut(s) 18
SaqAI TTAA 1 cut(s) 157
Sau96I GGNCC 1 cut(s) 18
SchI GAGTC 1 cut(s) 35
ScrFI CCNGG 1 cut(s) 105
SetI ASST 1 cut(s) 23
SgeI CNNG 8 cut(s) 33, 37, 58, 66, 70, 116, 117, 124
SinI GGWCC 1 cut(s) 18
Sse9I AATT 1 cut(s) 90
SspMI CTAG 1 cut(s) 147
StyD4I CCNGG 1 cut(s) 103
TasI AATT 1 cut(s) 90
TfiI GAWTC 1 cut(s) 135
Tru1I TTAA 1 cut(s) 157
Tru9I TTAA 1 cut(s) 157
TscAI CASTG 1 cut(s) 119
TspRI CASTG 1 cut(s) 119
VpaK11BI GGWCC 1 cut(s) 18
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.