RchiOBHm_Chr4g0445781

Belongs to the DEFL family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
66188970 .. 66189555
586 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41335

Sequence Viewer

Length: 246 bp
ATGGAGAGTTTCATGCGTGTGTTTTCGACTTTCTTCGTCGCTCTCTTGCTTCTGGTGGCTTCAGCTGGGATAGGACCAAATGTAATGGTTGCTGAGGCTAGAACTTGTGAGAGTCAGAGCCTCAAGTACGAGGGAATGTGCTTGAGAGAGAGCCACTGTGCATCTGTTTGCCAAACTGAGGGGTACAGTGGAGGCGACTGCCACGGTCTCTATAGCATATGTGTCTGTACCAAAGATTGTCAATGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

8.77

Weight (kDa)

5.11

Isoelectric Point (pI)

33.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Gamma-thionin PF00304 34 - 80 4.1e-15 Gamma-thionin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 45
AfaI GTAC 3 cut(s) 128, 185, 229
AfiI CCNNNNNNNGG 1 cut(s) 178
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
Alw26I GTCTC 1 cut(s) 212
AspS9I GGNCC 1 cut(s) 74
AvaII GGWCC 1 cut(s) 74
BbvCI CCTCAGC 1 cut(s) 93
BcoDI GTCTC 1 cut(s) 212
BfaI CTAG 1 cut(s) 99
BfmI CTRYAG 1 cut(s) 211
Bme18I GGWCC 1 cut(s) 74
BmgT120I GGNCC 1 cut(s) 74
BmsI GCATC 1 cut(s) 170
Bpu10I CCTNAGC 1 cut(s) 93
BpuEI CTTGAG 2 cut(s) 107, 163
BsaI GGTCTC 1 cut(s) 212
BsaJI CCNNGG 1 cut(s) 202
Bsc4I CCNNNNNNNGG 1 cut(s) 178
BseDI CCNNGG 1 cut(s) 202
BseLI CCNNNNNNNGG 1 cut(s) 178
BseMII CTCAG 2 cut(s) 84, 168
BseYI CCCAGC 1 cut(s) 65
BslI CCNNNNNNNGG 1 cut(s) 178
BsmAI GTCTC 1 cut(s) 212
Bso31I GGTCTC 1 cut(s) 212
BspCNI CTCAG 2 cut(s) 85, 169
BspTNI GGTCTC 1 cut(s) 212
BssECI CCNNGG 1 cut(s) 202
Bst4CI ACNGT 3 cut(s) 158, 188, 206
BstDEI CTNAG 2 cut(s) 93, 177
BstDSI CCRYGG 1 cut(s) 202
BstMAI GTCTC 1 cut(s) 212
BstSFI CTRYAG 1 cut(s) 211
BtgI CCRYGG 1 cut(s) 202
BtsIMutI CAGTG 2 cut(s) 154, 193
Cfr13I GGNCC 1 cut(s) 74
Csp6I GTAC 3 cut(s) 127, 184, 228
CviAII CATG 1 cut(s) 13
CviJI RGCY 5 cut(s) 59, 65, 98, 120, 153
CviKI_1 RGCY 5 cut(s) 59, 65, 98, 120, 153
CviQI GTAC 3 cut(s) 127, 184, 228
DdeI CTNAG 2 cut(s) 93, 177
Eco31I GGTCTC 1 cut(s) 212
Eco47I GGWCC 1 cut(s) 74
Eco57I CTGAAG 1 cut(s) 45
FaeI CATG 1 cut(s) 16
FaiI YATR 4 cut(s) 14, 213, 218, 220
FatI CATG 1 cut(s) 12
FauNDI CATATG 1 cut(s) 218
FspBI CTAG 1 cut(s) 99
GsaI CCCAGC 1 cut(s) 69
Hin1II CATG 1 cut(s) 16
HinfI GANTC 1 cut(s) 112
Hpy188I TCNGA 1 cut(s) 117
Hpy99I CGWCG 1 cut(s) 41
HpyCH4III ACNGT 3 cut(s) 158, 188, 206
HpyCH4V TGCA 1 cut(s) 161
HpyF3I CTNAG 2 cut(s) 93, 177
Hsp92II CATG 1 cut(s) 16
LpnPI CCDG 2 cut(s) 38, 51
LweI GCATC 1 cut(s) 170
MaeI CTAG 1 cut(s) 99
MboII GAAGA 1 cut(s) 25
MlyI GAGTC 1 cut(s) 121
MnlI CCTC 5 cut(s) 88, 124, 131, 172, 185
MslI CAYNNNNRTG 1 cut(s) 17
MspA1I CMGCKG 1 cut(s) 65
NdeI CATATG 1 cut(s) 218
NlaIII CATG 1 cut(s) 16
PleI GAGTC 1 cut(s) 120
PpsI GAGTC 1 cut(s) 120
PspFI CCCAGC 1 cut(s) 65
PspPI GGNCC 1 cut(s) 74
PvuII CAGCTG 1 cut(s) 65
RsaI GTAC 3 cut(s) 128, 185, 229
RsaNI GTAC 3 cut(s) 127, 184, 228
RseI CAYNNNNRTG 1 cut(s) 17
Sau96I GGNCC 1 cut(s) 74
SchI GAGTC 1 cut(s) 121
SetI ASST 1 cut(s) 67
SfaNI GCATC 1 cut(s) 170
SfcI CTRYAG 1 cut(s) 211
SinI GGWCC 1 cut(s) 74
SmiMI CAYNNNNRTG 1 cut(s) 17
SmlI CTYRAG 2 cut(s) 122, 142
SmoI CTYRAG 2 cut(s) 122, 142
SspMI CTAG 1 cut(s) 99
TaaI ACNGT 3 cut(s) 158, 188, 206
TaqI TCGA 1 cut(s) 26
TscAI CASTG 2 cut(s) 161, 193
TspRI CASTG 2 cut(s) 161, 193
VpaK11BI GGWCC 1 cut(s) 74
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.