Rmu_co8418995.1_g000001

Belongs to the DEFL family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8418995.1
Physical Location & Seq
Reverse (-)
1 .. 1244
1244 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8418995.1_g000001.1.cds

Sequence Viewer

Length: 205 bp
atggaaggtttcatgcgtttgttttcgactttcttcgtcggtctcctgcttctggtggctacagctgggatagggccaaatgtaatggttgctgaggccagaaaatgtgagagtcagagccacaagttcgagggaatttgcttgaaacagagcaattgtgcatctatttgcaaaactgagggttacagtggaggcaactgccgcg
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.34

Weight (kDa)

8.36

Isoelectric Point (pI)

35.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 204
AciI CCGC 1 cut(s) 202
AcsI RAATTY 1 cut(s) 135
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 145
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
Alw26I GTCTC 1 cut(s) 47
AoxI GGCC 2 cut(s) 74, 96
ApoI RAATTY 1 cut(s) 135
AspS9I GGNCC 1 cut(s) 74
BbvCI CCTCAGC 1 cut(s) 93
BcoDI GTCTC 1 cut(s) 47
BfmI CTRYAG 1 cut(s) 60
BisI GCNGC 1 cut(s) 202
BlsI GCNGC 1 cut(s) 203
BmgT120I GGNCC 1 cut(s) 74
BmsI GCATC 1 cut(s) 170
Bpu10I CCTNAGC 1 cut(s) 93
BsaI GGTCTC 1 cut(s) 47
Bsc4I CCNNNNNNNGG 1 cut(s) 52
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMII CTCAG 2 cut(s) 84, 168
BseYI CCCAGC 1 cut(s) 65
Bsh1236I CGCG 1 cut(s) 204
BshFI GGCC 2 cut(s) 76, 98
BslI CCNNNNNNNGG 1 cut(s) 52
BsmAI GTCTC 1 cut(s) 47
BsnI GGCC 2 cut(s) 76, 98
Bso31I GGTCTC 1 cut(s) 47
BspACI CCGC 1 cut(s) 202
BspANI GGCC 2 cut(s) 76, 98
BspCNI CTCAG 2 cut(s) 85, 169
BspFNI CGCG 1 cut(s) 204
BspTNI GGTCTC 1 cut(s) 47
Bst4CI ACNGT 1 cut(s) 188
BstDEI CTNAG 2 cut(s) 93, 177
BstFNI CGCG 1 cut(s) 204
BstMAI GTCTC 1 cut(s) 47
BstMWI GCNNNNNNNGC 1 cut(s) 201
BstSFI CTRYAG 1 cut(s) 60
BstUI CGCG 1 cut(s) 204
BsuRI GGCC 2 cut(s) 76, 98
BtsIMutI CAGTG 1 cut(s) 193
Cfr13I GGNCC 1 cut(s) 74
CviAII CATG 1 cut(s) 13
CviJI RGCY 5 cut(s) 59, 65, 76, 98, 120
CviKI_1 RGCY 5 cut(s) 59, 65, 76, 98, 120
DdeI CTNAG 2 cut(s) 93, 177
Eco31I GGTCTC 1 cut(s) 47
FaeI CATG 1 cut(s) 16
FaiI YATR 1 cut(s) 14
FatI CATG 1 cut(s) 12
Fnu4HI GCNGC 1 cut(s) 202
Fsp4HI GCNGC 1 cut(s) 202
GluI GCNGC 1 cut(s) 202
GsaI CCCAGC 1 cut(s) 69
HaeIII GGCC 2 cut(s) 76, 98
Hin1II CATG 1 cut(s) 16
HinfI GANTC 1 cut(s) 112
Hpy188I TCNGA 1 cut(s) 117
Hpy99I CGWCG 1 cut(s) 41
HpyCH4III ACNGT 1 cut(s) 188
HpyCH4V TGCA 2 cut(s) 161, 171
HpyF10VI GCNNNNNNNGC 1 cut(s) 201
HpyF3I CTNAG 2 cut(s) 93, 177
Hsp92II CATG 1 cut(s) 16
LpnPI CCDG 4 cut(s) 38, 51, 59, 112
LweI GCATC 1 cut(s) 170
MaeIII GTNAC 1 cut(s) 182
MboII GAAGA 1 cut(s) 25
MfeI CAATTG 1 cut(s) 154
MluCI AATT 2 cut(s) 135, 154
MlyI GAGTC 1 cut(s) 121
MnlI CCTC 4 cut(s) 88, 124, 172, 185
MspA1I CMGCKG 1 cut(s) 65
MunI CAATTG 1 cut(s) 154
MvnI CGCG 1 cut(s) 204
MwoI GCNNNNNNNGC 1 cut(s) 201
NlaIII CATG 1 cut(s) 16
PkrI GCNGC 1 cut(s) 203
PleI GAGTC 1 cut(s) 120
PpsI GAGTC 1 cut(s) 120
PspFI CCCAGC 1 cut(s) 65
PspPI GGNCC 1 cut(s) 74
PvuII CAGCTG 1 cut(s) 65
SatI GCNGC 1 cut(s) 202
Sau96I GGNCC 1 cut(s) 74
SchI GAGTC 1 cut(s) 121
SetI ASST 2 cut(s) 10, 67
SfaNI GCATC 1 cut(s) 170
SfcI CTRYAG 1 cut(s) 60
SgeI CNNG 8 cut(s) 25, 58, 65, 78, 111, 136, 142, 154
Sse9I AATT 2 cut(s) 135, 154
SsiI CCGC 1 cut(s) 202
TaaI ACNGT 1 cut(s) 188
TaqI TCGA 2 cut(s) 26, 129
TaqII GACCGA 1 cut(s) 29
TasI AATT 2 cut(s) 135, 154
TauI GCSGC 1 cut(s) 204
TscAI CASTG 1 cut(s) 193
TspRI CASTG 1 cut(s) 193
XapI RAATTY 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.