Prupe.1G458700_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0001092
Physical Location & Seq
Reverse (-)
38403775 .. 38404143
369 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G458700.1

Sequence Viewer

Length: 369 bp
ATGCAAGGTCTCACTTTCAAGATTAAGGAATTGGAAAAGGTTGTGGAACAAAAGAACCTAGATCTTGAGAACCTTGAAGCTTCTCACGGGAAGGTTATGAAAAAGCTTTCCGTCACTGTGAGTAAGTTTGATGAGCAACATCATCTATCTGCAAACCTCCTTGCCGAGGTGGAAAAGCTCCAATCACAATTTCAAGATCGGGATGCTGAGATATCTTTCTTAAGGCAAGAGGTCACTAGGTGTACCAATGATGTTCTTGTTGCATCTCAAACCAGCAACAAGAGAAGTTCAGATGAGATCCATGAGTTATTAACATGGTTTGATATGAATATCTTATCGAGGTGTTGGAGATTCTGGCAGAGGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

14.37

Weight (kDa)

6.08

Isoelectric Point (pI)

45.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 292
AdeI CACNNNGTG 1 cut(s) 240
AfaI GTAC 1 cut(s) 244
AfiI CCNNNNNNNGG 1 cut(s) 166
AflII CTTAAG 1 cut(s) 220
AgsI TTSAA 3 cut(s) 19, 77, 194
AjuI GAANNNNNNNTTGG 2 cut(s) 174, 206
AluBI AGCT 3 cut(s) 80, 106, 178
AluI AGCT 3 cut(s) 80, 106, 178
Alw26I GTCTC 1 cut(s) 14
AlwI GGATC 1 cut(s) 292
BcoDI GTCTC 1 cut(s) 14
BfaI CTAG 3 cut(s) 59, 237, 367
BfrI CTTAAG 1 cut(s) 220
BglII AGATCT 1 cut(s) 61
BmsI GCATC 2 cut(s) 193, 272
BpuEI CTTGAG 1 cut(s) 86
BsaI GGTCTC 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 165
Bsc4I CCNNNNNNNGG 1 cut(s) 166
BseDI CCNNGG 1 cut(s) 165
BseGI GGATG 1 cut(s) 208
BseLI CCNNNNNNNGG 1 cut(s) 166
BseMII CTCAG 1 cut(s) 198
BslI CCNNNNNNNGG 1 cut(s) 166
BsmAI GTCTC 1 cut(s) 14
Bso31I GGTCTC 1 cut(s) 14
Bsp143I GATC 3 cut(s) 61, 196, 297
BspCNI CTCAG 1 cut(s) 199
BspPI GGATC 1 cut(s) 292
BspTI CTTAAG 1 cut(s) 220
BspTNI GGTCTC 1 cut(s) 14
BssECI CCNNGG 1 cut(s) 165
BssMI GATC 3 cut(s) 61, 196, 297
Bst4CI ACNGT 1 cut(s) 118
BstAFI CTTAAG 1 cut(s) 220
BstDEI CTNAG 1 cut(s) 207
BstENI CCTNNNNNAGG 1 cut(s) 164
BstF5I GGATG 1 cut(s) 208
BstKTI GATC 3 cut(s) 64, 199, 300
BstMAI GTCTC 1 cut(s) 14
BstMBI GATC 3 cut(s) 61, 196, 297
BstX2I RGATCY 2 cut(s) 61, 297
BstYI RGATCY 2 cut(s) 61, 297
BtsCI GGATG 1 cut(s) 208
BtsIMutI CAGTG 1 cut(s) 114
Csp6I GTAC 1 cut(s) 243
CviAII CATG 2 cut(s) 302, 315
CviJI RGCY 3 cut(s) 80, 106, 178
CviKI_1 RGCY 3 cut(s) 80, 106, 178
CviQI GTAC 1 cut(s) 243
DdeI CTNAG 1 cut(s) 207
DpnI GATC 3 cut(s) 63, 198, 299
DpnII GATC 3 cut(s) 61, 196, 297
DraIII CACNNNGTG 1 cut(s) 240
Eco31I GGTCTC 1 cut(s) 14
Eco32I GATATC 1 cut(s) 213
EcoNI CCTNNNNNAGG 1 cut(s) 164
EcoRV GATATC 1 cut(s) 213
FaeI CATG 2 cut(s) 305, 318
FaiI YATR 4 cut(s) 98, 303, 316, 326
FatI CATG 2 cut(s) 301, 314
FokI GGATG 1 cut(s) 215
FspBI CTAG 3 cut(s) 59, 237, 367
Hin1II CATG 2 cut(s) 305, 318
HindIII AAGCTT 2 cut(s) 78, 104
HinfI GANTC 1 cut(s) 351
Hpy166II GTNNAC 1 cut(s) 243
Hpy188I TCNGA 1 cut(s) 292
Hpy188III TCNNGA 4 cut(s) 19, 65, 194, 200
Hpy8I GTNNAC 1 cut(s) 243
HpyAV CCTTC 1 cut(s) 85
HpyCH4III ACNGT 1 cut(s) 118
HpyCH4V TGCA 3 cut(s) 4, 152, 263
HpyF3I CTNAG 1 cut(s) 207
Hsp92II CATG 2 cut(s) 305, 318
Kzo9I GATC 3 cut(s) 61, 196, 297
LmnI GCTCC 1 cut(s) 183
LpnPI CCDG 2 cut(s) 286, 340
LweI GCATC 2 cut(s) 193, 272
MaeI CTAG 3 cut(s) 59, 237, 367
MaeIII GTNAC 2 cut(s) 112, 232
MalI GATC 3 cut(s) 63, 198, 299
MboI GATC 3 cut(s) 61, 196, 297
MflI RGATCY 2 cut(s) 61, 297
MluCI AATT 2 cut(s) 29, 188
MmeI TCCRAC 1 cut(s) 326
MnlI CCTC 5 cut(s) 160, 167, 223, 333, 354
MseI TTAA 3 cut(s) 24, 221, 311
MspCI CTTAAG 1 cut(s) 220
NdeII GATC 3 cut(s) 61, 196, 297
NlaIII CATG 2 cut(s) 305, 318
NmeAIII GCCGAG 1 cut(s) 190
NmuCI GTSAC 2 cut(s) 112, 232
PfeI GAWTC 1 cut(s) 351
PsuI RGATCY 2 cut(s) 61, 297
RsaI GTAC 1 cut(s) 244
RsaNI GTAC 1 cut(s) 243
SaqAI TTAA 3 cut(s) 24, 221, 311
Sau3AI GATC 3 cut(s) 61, 196, 297
SfaNI GCATC 2 cut(s) 193, 272
SmlI CTYRAG 2 cut(s) 65, 220
SmoI CTYRAG 2 cut(s) 65, 220
Sse9I AATT 2 cut(s) 29, 188
SspMI CTAG 3 cut(s) 59, 237, 367
TaaI ACNGT 1 cut(s) 118
TaqI TCGA 1 cut(s) 338
TasI AATT 2 cut(s) 29, 188
TfiI GAWTC 1 cut(s) 351
Tru1I TTAA 3 cut(s) 24, 221, 311
Tru9I TTAA 3 cut(s) 24, 221, 311
TscAI CASTG 1 cut(s) 121
TseFI GTSAC 2 cut(s) 112, 232
Tsp45I GTSAC 2 cut(s) 112, 232
TspDTI ATGAA 2 cut(s) 113, 341
TspGWI ACGGA 1 cut(s) 100
TspRI CASTG 1 cut(s) 121
Vha464I CTTAAG 1 cut(s) 220
XagI CCTNNNNNAGG 1 cut(s) 164
XspI CTAG 3 cut(s) 59, 237, 367
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.