Rmu_sc0020469.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020469.1
OG0001092
Physical Location & Seq
Forward (+)
1 .. 6209
6209 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020469.1_g000001.1.cds

Sequence Viewer

Length: 4461 bp
aacactttacatgtgactgattcagatcagaagagttctgccggtggaggttcatactctgatgctggttttgttgttatgaattcctggaaagatgatgtacaggcagtacagccaagttcagattcaagtgaagatatcaaaagaaaatatgatgaactaaagattagattttatgggttgactgaacagaatgaaatgttggaaaaatccttaatggcaaggaacaacatagtacagagatgggaggaacttttggataggatcgacatgccaccacatctgcgatctgtggagccaaaggataggatcgattggttaagcaaagcacttttagaagcgcaggaagataataagtctctgcagcagaaggttgttaaccttagaaaccattgtgtatcactcactgctgatttggaagactcgcaaaggggaatgtctgaccttgaggcagaccttcaaagatgtatccacaagagagattatctttccgaaagattggagactctggtcaatgatcaggagaagctttcaaccaaggcagctgaatttgagcttgagaatgaaaagctgcagaagaaagttactgatttgcaagaaaatgtagccaagatgcatggaaatgagaatcaaattctcagcatagaagctgacttaagaagattacagagtttggttactgatgccttggaggtctctggatcaaagtatgagtattctggtggtagtagcattgagtgcttggaagggttactgaataagcttttagagagttatgcaactctttactcggaaaaacctgtgcatgggggtgccgctgaaggcctccatactgaatatgctgatgcaacagttattggatcaagaagcctaaatacacttggttcccaggaatcagatgtagatgttttaaagaaagagttggaggaggttcaacatgaacttttgggtgtgaaggaggagagggatggatatctagagaaggaacagtctatggctagtgaatttcaagcattacataacaaagtgaatgagttgcaagggctgcttaatcaagaggagcagaagttagcttctgttagagagaagttaaatgttgcagtcagaaaagggaagtcattggtacaacagcgtgacagtctgaaacaaagtattgatgaggtcaattctgaggtcgaacgtttgagatcagagatcaagatggggcaagttaaaattgcagagtatgaacaaaacttcagggatttgtctacttaccctagcagggtagaagccttagaatctgagacattgttcttgaggaattgtttgaatgaaactgagcagaatttgcagcacaaagaaaatactttgagcctgattgtaaatatcttagacaacattgatgtaggaggcgattttaactctcgtgatccagttgtgaagttagaccaaattgggaaaatgtgctttgatctgcgcgctgatgtagcaacttctgagcaagaggttaggaaatccaaaagagcagcagagctactccttgcagaactgaatgaggttcaagagaggaacgatggtctccaagaagagcttgcaaaatctgctgatgaaatttctgtactctccaaggaaagggatcttgctgaggcgagcaaacttgaagctgttttaagtcttgaaaagctatctactgctcactccgaggaaagaaaagaccaattttctgaatttgcaggactgaaatctggtctagatcaactcaggaagggtttccatgatattaacaattcattggccgatattttttacaacgacttcgaatttttgaacaacctggagtctggtattgactcatgtctcaaattaaatagtgctaatgtggttgatgtgcaccccttcactgcagctggtggatttctaacgagcaaatcagataaggataactctatttcaatgaattctaggtcagacaccaatgcgcgtggacattttggtgacagttttgtcatcgaaacctttacatacataacacattatgtgcaagagctcatgacggagattggtgtgcttaaagaaaaattagatgaacactcaatgtctttgcatgaaaaatctagcagtgtatccagattggtggcaattgtttgtggagagataacttccaaaaacgagtcatttgaagccttgaggagagactttttgcagatggaaatggtcaaaaaggaaaaggacaaggaacttgttgtcttgcatagaaatgctgctgtgctttttgaagcatgcactagttcagctgtgaaaataaatagaagaaaagatgaattggtgggaaatagttgggctgttggagatctgggaatgacatcaaaaccaacagaattgcccgctttcagtggagagggtcagctttactctgaggaatctgttaggtctgtggcagacaggcttttgtcggctgctagtgattttgctactctgacagctaaaatagttgaacgcagccaaaaggaaatgaagcttaccatttcaaatttgcagaaagagcttcaggagaaggacgttcaaaaggagaggattttcatggagcttgtaagtcaaatcatggaagctgaagctactgcaagcagctattcagtggaccttgaatcttcaaaaaccttggtgcatgatttggagaaacagttggaagcgatgaaaggtgaacgcaacttatttgagcggcgagtaaaggagctagaagatggccaggccacctctgccgatttacaacagagggtcagaacactaactgatgtgcttgctgccaaagaccatgaaattgagcagctaattcaagcacttgatgaggaggaggtacagatgcaaggtatcaccttcaagatcaaggaactggaaaagattgttgaacaaaaaaacctagatttagagaaccttgaagcttctcgtggcaaggtgatgaaaaagctcttcgtcactgtgaataagtttgacgagctgcatcatctatctgcaagcctcctagcggaagttgaagaactgcagtcacagttgcaagatcgggatgcagagatttctttcttaaggcaagaggtcactaggtgcaccaatgatgttctggttgcatcacaagtcagtaagaagggaaattcagatgagatccacgagttattaacatggtttgatatgaatgttgctcgatttggggtgcgcagtgagtatcttgaagataagaacaacagtgacatcgctgaacaaatggaagtactcaagaagacagttgattctattttatcagaattgggggatctacgggctgctgctcaaagcaaagatatattgttgcaagaagaaagggctaaggtagaaggattagcacgcaagggccagaatcttgaaaagtggttgcgggagaaggaatcacaaattgtagaaattgagaagctgatgcaagcacttgatgaggaggaggtacagatgcaaggtatcaccttcaagatcaaggaactggaaaagattgtggaacaaaagaacctagatttagagaaccttgaagcttctcgtgggaaggttatgaaaaagctctccatcaccgtgtataagtttgacgagctgcatcacctatctgcaagcctccttgcggaagttgaaaaattgcagtcacaattgcaagatcgggatgcagagatttctttcttaaggcgagaggtcactaggtgcaccaatgatgttctggttgcatcacaagtcagtaagaagggaaattctgatgagatccacgagttattaacatggtttgatatgaatattgctgcatttggggtccacagtgagtatcttgaaaataagaacaacagtgacgtccctgaacaaaaggaagtattcaagaagacagttgattcaattttatcagaattaggggatctacgggctgcggctcaaagcaaagatatattgttgcaagaagaaaggactaaggtagaagaattaacacacaagggtcagactcttgaggagtgtttacgggagaaggaatcacgattaaatctgcttgaaggtgtggaagacggccaagcaactagctcgacctcagagattcatgaagttgagcctgcgataaacaaatgggaagcatctggttcctccattgcatctcaagtccgcagtttgcgcaaaggcaacagtgagcaagttgcaattgccatagatatggatcctgggagcactagtaaattggaagatgaagaagatgataagggtaatcctatggctgtagttgccgccatcttttacgttcatggtttcaagtcgctcactacatcaagaatggtccctagatgtacaagacctgtgagtgacatggtcgatggcctctgcccttatgcacccgtgtgccgcctactgcccctacagcatcgccgcacacctgcagcacagcaagacactcgttcctgtgcagatcatcctgcttgcaagccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

1486

Amino Acids

167.75

Weight (kDa)

4.93

Isoelectric Point (pI)

50.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 4414
AasI GACNNNNNNGTC 1 cut(s) 1985
AatII GACGTC 1 cut(s) 3843
Acc16I TGCGCA 2 cut(s) 3191, 4151
Acc36I ACCTGC 1 cut(s) 4414
AccB1I GGYRCC 1 cut(s) 812
AccBSI CCGCTC 1 cut(s) 2701
AccI GTMKAC 1 cut(s) 1250
AccII CGCG 2 cut(s) 1461, 1963
AclI AACGTT 1 cut(s) 1180
AcoI YGGCCR 3 cut(s) 1776, 2725, 4048
AcuI CTGAAG 4 cut(s) 840, 1222, 2513, 2613
AcyI GRCGYC 1 cut(s) 3840
AdeI CACNNNGTG 2 cut(s) 3081, 3696
AfaI GTAC 9 cut(s) 102, 111, 237, 1125, 1602, 2838, 3246, 3453, 4321
AfiI CCNNNNNNNGG 5 cut(s) 806, 1264, 1614, 3004, 3619
AflII CTTAAG 3 cut(s) 655, 3061, 3676
AflIII ACRYGT 1 cut(s) 10
AhlI ACTAGT 2 cut(s) 2267, 4205
AjnI CCWGG 5 cut(s) 86, 888, 1815, 2727, 4195
AjuI GAANNNNNNNTTGG 4 cut(s) 109, 141, 185, 217
AleI CACNNNNGTG 1 cut(s) 4369
Alw21I GWGCWC 5 cut(s) 1875, 2031, 3086, 3701, 4205
Alw26I GTCTC 7 cut(s) 363, 497, 700, 1280, 1565, 1844, 2169
Alw44I GTGCAC 3 cut(s) 1871, 3082, 3697
AoxI GGCC 7 cut(s) 823, 1776, 2725, 2730, 3364, 4048, 4348
ApaLI GTGCAC 3 cut(s) 1871, 3082, 3697
Asp700I GAANNNNTTC 1 cut(s) 1751
AspLEI GCGC 6 cut(s) 343, 1461, 1463, 1963, 3192, 4152
AspS9I GGNCC 4 cut(s) 2620, 3364, 3802, 4309
AsuHPI GGTGA 7 cut(s) 1988, 2693, 2845, 2947, 3460, 3562, 3590
AsuII TTCGAA 1 cut(s) 1800
AvaII GGWCC 3 cut(s) 2620, 3802, 4309
BaeGI GKGCMC 3 cut(s) 1875, 3086, 3701
BalI TGGCCA 1 cut(s) 2727
BamHI GGATCC 1 cut(s) 4192
BanI GGYRCC 1 cut(s) 812
BanII GRGCYC 1 cut(s) 2031
BarI GAAGNNNNNNTAC 2 cut(s) 859, 891
BauI CACGAG 5 cut(s) 1407, 2925, 3143, 3540, 3758
BbsI GAAGAC 4 cut(s) 426, 3260, 3875, 4050
Bbv12I GWGCWC 5 cut(s) 1875, 2031, 3086, 3701, 4205
BbvCI CCTCAGC 1 cut(s) 1626
BccI CCATC 9 cut(s) 237, 962, 1195, 1550, 2182, 2717, 3575, 4271, 4340
BceAI ACGGC 1 cut(s) 4063
BcgI CGANNNNNNTGC 4 cut(s) 4044, 4078, 4406, 4440
BciT130I CCWGG 5 cut(s) 88, 890, 1817, 2729, 4197
BciVI GTATCC 2 cut(s) 479, 2116
BclI TGATCA 1 cut(s) 517
BcoDI GTCTC 7 cut(s) 363, 497, 700, 1280, 1565, 1844, 2169
BcuI ACTAGT 2 cut(s) 2267, 4205
BfmI CTRYAG 7 cut(s) 362, 572, 1884, 3020, 4251, 4388, 4407
BfrI CTTAAG 3 cut(s) 655, 3061, 3676
BfuAI ACCTGC 1 cut(s) 4414
BfuI GTATCC 2 cut(s) 479, 2116
BglII AGATCT 1 cut(s) 2332
BmcAI AGTACT 1 cut(s) 3246
Bme1390I CCNGG 5 cut(s) 88, 890, 1817, 2729, 4197
Bme18I GGWCC 3 cut(s) 2620, 3802, 4309
BmgT120I GGNCC 4 cut(s) 2620, 3364, 3802, 4309
BmiI GGNNCC 7 cut(s) 297, 814, 886, 3803, 4120, 4194, 4311
BmrFI CCNGG 5 cut(s) 88, 890, 1817, 2729, 4197
BoxI GACNNNNGTC 2 cut(s) 509, 1836
BpiI GAAGAC 4 cut(s) 426, 3260, 3875, 4050
BpmI CTGGAG 1 cut(s) 1838
Bpu10I CCTNAGC 2 cut(s) 1626, 3339
Bpu14I TTCGAA 1 cut(s) 1800
BpuEI CTTGAG 7 cut(s) 467, 578, 1318, 2188, 3233, 4010, 4119
Bsa29I ATCGAT 1 cut(s) 312
BsaBI GATNNNNATC 3 cut(s) 24, 972, 4191
BsaHI GRCGYC 1 cut(s) 3840
BsaI GGTCTC 2 cut(s) 700, 1565
BsaJI CCNNGG 7 cut(s) 537, 687, 888, 1608, 1683, 2640, 4196
BsaXI ACNNNNNCTCC 6 cut(s) 1052, 1082, 2648, 2678, 4192, 4222
Bsc4I CCNNNNNNNGG 5 cut(s) 806, 1264, 1614, 3004, 3619
Bse118I RCCGGY 1 cut(s) 41
Bse1I ACTGG 3 cut(s) 1415, 2877, 3492
Bse3DI GCAATG 1 cut(s) 4125
Bse8I GATNNNNATC 3 cut(s) 24, 972, 4191
BseBI CCWGG 5 cut(s) 88, 890, 1817, 2729, 4197
BseCI ATCGAT 1 cut(s) 312
BseDI CCNNGG 7 cut(s) 537, 687, 888, 1608, 1683, 2640, 4196
BseGI GGATG 4 cut(s) 973, 3049, 3664, 4441
BseJI GATNNNNATC 3 cut(s) 24, 972, 4191
BseLI CCNNNNNNNGG 5 cut(s) 806, 1264, 1614, 3004, 3619
BseMI GCAATG 1 cut(s) 4125
BseMII CTCAG 9 cut(s) 652, 1161, 1275, 1311, 1470, 1617, 1756, 2388, 4083
BseNI ACTGG 3 cut(s) 1415, 2877, 3492
BsePI GCGCGC 1 cut(s) 1459
BseRI GAGGAG 9 cut(s) 941, 974, 1073, 2185, 2843, 2846, 3458, 3461, 4007
BseSI GKGCMC 3 cut(s) 1875, 3086, 3701
BsgI GTGCAG 1 cut(s) 4455
Bsh1236I CGCG 2 cut(s) 1461, 1963
BshFI GGCC 7 cut(s) 825, 1778, 2727, 2732, 3366, 4050, 4350
BshNI GGYRCC 1 cut(s) 812
BshVI ATCGAT 1 cut(s) 312
BsiHKAI GWGCWC 5 cut(s) 1875, 2031, 3086, 3701, 4205
BsiSI CCGG 1 cut(s) 42
BslFI GGGAC 2 cut(s) 3827, 4295
BslI CCNNNNNNNGG 5 cut(s) 806, 1264, 1614, 3004, 3619
BsmAI GTCTC 7 cut(s) 363, 497, 700, 1280, 1565, 1844, 2169
BsmFI GGGAC 2 cut(s) 3827, 4295
BsnI GGCC 7 cut(s) 825, 1778, 2727, 2732, 3366, 4050, 4350
Bso31I GGTCTC 2 cut(s) 700, 1565
Bsp119I TTCGAA 1 cut(s) 1800
Bsp1286I GDGCHC 5 cut(s) 1875, 2031, 3086, 3701, 4205
Bsp1407I TGTACA 2 cut(s) 100, 4319
BspANI GGCC 7 cut(s) 825, 1778, 2727, 2732, 3366, 4050, 4350
BspCNI CTCAG 9 cut(s) 651, 1162, 1276, 1312, 1471, 1618, 1755, 2389, 4082
BspDI ATCGAT 1 cut(s) 312
BspFNI CGCG 2 cut(s) 1461, 1963
BspHI TCATGA 2 cut(s) 2031, 4078
BspLI GGNNCC 7 cut(s) 297, 814, 886, 3803, 4120, 4194, 4311
BspMAI CTGCAG 5 cut(s) 366, 576, 1888, 3024, 4411
BspMI ACCTGC 1 cut(s) 4414
BspQI GCTCTTC 2 cut(s) 1563, 2954
BspT104I TTCGAA 1 cut(s) 1800
BspT107I GGYRCC 1 cut(s) 812
BspTI CTTAAG 3 cut(s) 655, 3061, 3676
BspTNI GGTCTC 2 cut(s) 700, 1565
BsrBI CCGCTC 1 cut(s) 2701
BsrDI GCAATG 1 cut(s) 4125
BsrFI RCCGGY 1 cut(s) 41
BsrGI TGTACA 2 cut(s) 100, 4319
BsrI ACTGG 3 cut(s) 1415, 2877, 3492
BssAI RCCGGY 1 cut(s) 41
BssECI CCNNGG 7 cut(s) 537, 687, 888, 1608, 1683, 2640, 4196
BssHII GCGCGC 1 cut(s) 1459
BssNI GRCGYC 1 cut(s) 3840
BssSI CACGAG 5 cut(s) 1407, 2925, 3143, 3540, 3758
BssT1I CCWWGG 4 cut(s) 537, 687, 1608, 2640
Bst2BI CACGAG 5 cut(s) 1407, 2925, 3143, 3540, 3758
Bst2UI CCWGG 5 cut(s) 88, 890, 1817, 2729, 4197
Bst6I CTCTTC 3 cut(s) 26, 1563, 2954
BstACI GRCGYC 1 cut(s) 3840
BstAFI CTTAAG 3 cut(s) 655, 3061, 3676
BstAPI GCANNNNNTGC 4 cut(s) 738, 1045, 1330, 1583
BstAUI TGTACA 2 cut(s) 100, 4319
BstBI TTCGAA 1 cut(s) 1800
BstF5I GGATG 4 cut(s) 973, 3049, 3664, 4441
BstFNI CGCG 2 cut(s) 1461, 1963
BstHHI GCGC 6 cut(s) 343, 1461, 1463, 1963, 3192, 4152
BstMAI GTCTC 7 cut(s) 363, 497, 700, 1280, 1565, 1844, 2169
BstNI CCWGG 5 cut(s) 88, 890, 1817, 2729, 4197
BstNSI RCATGY 3 cut(s) 14, 274, 2265
BstPAI GACNNNNGTC 2 cut(s) 509, 1836
BstSCI CCNGG 5 cut(s) 86, 888, 1815, 2727, 4195
BstSFI CTRYAG 7 cut(s) 362, 572, 1884, 3020, 4251, 4388, 4407
BstSLI GKGCMC 3 cut(s) 1875, 3086, 3701
BstUI CGCG 2 cut(s) 1461, 1963
BstV2I GAAGAC 4 cut(s) 426, 3260, 3875, 4050
BstX2I RGATCY 7 cut(s) 1618, 2332, 3138, 3286, 3753, 3901, 4192
BstXI CCANNNNNNTGG 2 cut(s) 2116, 4189
BstYI RGATCY 7 cut(s) 1618, 2332, 3138, 3286, 3753, 3901, 4192
Bsu15I ATCGAT 1 cut(s) 312
BsuI GTATCC 2 cut(s) 479, 2116
BsuRI GGCC 7 cut(s) 825, 1778, 2727, 2732, 3366, 4050, 4350
BsuTUI ATCGAT 1 cut(s) 312
BtgZI GCGATG 3 cut(s) 2687, 3211, 4379
BtsCI GGATG 4 cut(s) 973, 3049, 3664, 4441
BtsI GCAGTG 4 cut(s) 405, 1881, 2107, 3199
BveI ACCTGC 1 cut(s) 4414
CciI TCATGA 2 cut(s) 2031, 4078
CfoI GCGC 6 cut(s) 343, 1461, 1463, 1963, 3192, 4152
Cfr10I RCCGGY 1 cut(s) 41
Cfr13I GGNCC 4 cut(s) 2620, 3364, 3802, 4309
ClaI ATCGAT 1 cut(s) 312
Csp6I GTAC 9 cut(s) 101, 110, 236, 1124, 1601, 2837, 3245, 3452, 4320
CspCI CAANNNNNGTGG 2 cut(s) 1945, 1980
CviQI GTAC 9 cut(s) 101, 110, 236, 1124, 1601, 2837, 3245, 3452, 4320
DraI TTTAAA 1 cut(s) 912
DraIII CACNNNGTG 2 cut(s) 3081, 3696
DrdI GACNNNNNNGTC 1 cut(s) 1985
DseDI GACNNNNNNGTC 1 cut(s) 1985
EaeI YGGCCR 3 cut(s) 1776, 2725, 4048
Eam1104I CTCTTC 3 cut(s) 26, 1563, 2954
EarI CTCTTC 3 cut(s) 26, 1563, 2954
Ecl136II GAGCTC 1 cut(s) 2029
Eco130I CCWWGG 4 cut(s) 537, 687, 1608, 2640
Eco147I AGGCCT 1 cut(s) 825
Eco24I GRGCYC 1 cut(s) 2031
Eco31I GGTCTC 2 cut(s) 700, 1565
Eco32I GATATC 2 cut(s) 139, 974
Eco47I GGWCC 3 cut(s) 2620, 3802, 4309
Eco53kI GAGCTC 1 cut(s) 2029
Eco57I CTGAAG 4 cut(s) 840, 1222, 2513, 2613
EcoICRI GAGCTC 1 cut(s) 2029
EcoRI GAATTC 2 cut(s) 82, 1939
EcoRII CCWGG 5 cut(s) 86, 888, 1815, 2727, 4195
EcoRV GATATC 2 cut(s) 139, 974
EcoT14I CCWWGG 4 cut(s) 537, 687, 1608, 2640
EcoT22I ATGCAT 1 cut(s) 618
EcoT38I GRGCYC 1 cut(s) 2031
ErhI CCWWGG 4 cut(s) 537, 687, 1608, 2640
FalI AAGNNNNNCTT 4 cut(s) 1032, 1064, 1557, 1589
FaqI GGGAC 2 cut(s) 3827, 4295
FauI CCCGC 2 cut(s) 2374, 3381
FbaI TGATCA 1 cut(s) 517
FblI GTMKAC 1 cut(s) 1250
FokI GGATG 4 cut(s) 980, 3056, 3671, 4428
FriOI GRGCYC 1 cut(s) 2031
FspI TGCGCA 2 cut(s) 3191, 4151
GlaI GCGC 6 cut(s) 342, 1460, 1462, 1962, 3191, 4151
GsuI CTGGAG 1 cut(s) 1838
HaeIII GGCC 7 cut(s) 825, 1778, 2727, 2732, 3366, 4050, 4350
HapII CCGG 1 cut(s) 42
HhaI GCGC 6 cut(s) 343, 1461, 1463, 1963, 3192, 4152
Hin1I GRCGYC 1 cut(s) 3840
Hin6I GCGC 6 cut(s) 341, 1459, 1461, 1961, 3190, 4150
HinP1I GCGC 6 cut(s) 341, 1459, 1461, 1961, 3190, 4150
HincII GTYRAC 2 cut(s) 183, 379
HindII GTYRAC 2 cut(s) 183, 379
HindIII AAGCTT 5 cut(s) 527, 761, 2498, 2919, 3534
HpaI GTTAAC 1 cut(s) 379
HpaII CCGG 1 cut(s) 42
HphI GGTGA 7 cut(s) 1988, 2693, 2845, 2947, 3460, 3562, 3590
HpyCH4IV ACGT 4 cut(s) 1180, 2541, 3840, 4272
HpySE526I ACGT 4 cut(s) 1180, 2541, 3840, 4272
Hsp92I GRCGYC 1 cut(s) 3840
HspAI GCGC 6 cut(s) 341, 1459, 1461, 1961, 3190, 4150
Ksp22I TGATCA 1 cut(s) 517
KspAI GTTAAC 1 cut(s) 379
LguI GCTCTTC 2 cut(s) 1563, 2954
LmnI GCTCC 5 cut(s) 295, 1060, 2566, 2713, 4200
MaeII ACGT 4 cut(s) 1180, 2541, 3840, 4272
MbiI CCGCTC 1 cut(s) 2701
MfeI CAATTG 3 cut(s) 2121, 3644, 4176
MflI RGATCY 7 cut(s) 1618, 2332, 3138, 3286, 3753, 3901, 4192
MhlI GDGCHC 5 cut(s) 1875, 2031, 3086, 3701, 4205
MlsI TGGCCA 1 cut(s) 2727
MluNI TGGCCA 1 cut(s) 2727
MlyI GAGTC 6 cut(s) 416, 499, 1826, 1829, 2162, 3979
MmeI TCCRAC 4 cut(s) 183, 903, 2308, 2646
Mox20I TGGCCA 1 cut(s) 2727
Mph1103I ATGCAT 1 cut(s) 618
MroXI GAANNNNTTC 1 cut(s) 1751
MscI TGGCCA 1 cut(s) 2727
MslI CAYNNNNRTG 7 cut(s) 621, 810, 1974, 2238, 3572, 4187, 4369
Msp20I TGGCCA 1 cut(s) 2727
MspA1I CMGCKG 4 cut(s) 545, 818, 1889, 2276
MspCI CTTAAG 3 cut(s) 655, 3061, 3676
MspI CCGG 1 cut(s) 42
MspR9I CCNGG 5 cut(s) 88, 890, 1817, 2729, 4197
MunI CAATTG 3 cut(s) 2121, 3644, 4176
MvaI CCWGG 5 cut(s) 88, 890, 1817, 2729, 4197
MvnI CGCG 2 cut(s) 1461, 1963
NlaIV GGNNCC 7 cut(s) 297, 814, 886, 3803, 4120, 4194, 4311
NsbI TGCGCA 2 cut(s) 3191, 4151
NsiI ATGCAT 1 cut(s) 618
NspI RCATGY 3 cut(s) 14, 274, 2265
NspV TTCGAA 1 cut(s) 1800
OliI CACNNNNGTG 1 cut(s) 4369
PaeI GCATGC 1 cut(s) 2265
PagI TCATGA 2 cut(s) 2031, 4078
PaqCI CACCTGC 1 cut(s) 4414
PauI GCGCGC 1 cut(s) 1459
PceI AGGCCT 1 cut(s) 825
PciI ACATGT 1 cut(s) 10
PciSI GCTCTTC 2 cut(s) 1563, 2954
PdmI GAANNNNTTC 1 cut(s) 1751
PflFI GACNNNGTC 1 cut(s) 4340
PfoI TCCNGGA 1 cut(s) 86
PleI GAGTC 6 cut(s) 416, 499, 1826, 1828, 2161, 3979
PpsI GAGTC 6 cut(s) 416, 499, 1826, 1828, 2161, 3979
PscI ACATGT 1 cut(s) 10
PshAI GACNNNNGTC 2 cut(s) 509, 1836
Psp124BI GAGCTC 1 cut(s) 2031
Psp1406I AACGTT 1 cut(s) 1180
Psp6I CCWGG 5 cut(s) 86, 888, 1815, 2727, 4195
PspGI CCWGG 5 cut(s) 86, 888, 1815, 2727, 4195
PspN4I GGNNCC 7 cut(s) 297, 814, 886, 3803, 4120, 4194, 4311
PspPI GGNCC 4 cut(s) 2620, 3364, 3802, 4309
PstI CTGCAG 5 cut(s) 366, 576, 1888, 3024, 4411
PsuI RGATCY 7 cut(s) 1618, 2332, 3138, 3286, 3753, 3901, 4192
PsyI GACNNNGTC 1 cut(s) 4340
PteI GCGCGC 1 cut(s) 1459
PvuII CAGCTG 3 cut(s) 545, 1889, 2276
RsaI GTAC 9 cut(s) 102, 111, 237, 1125, 1602, 2838, 3246, 3453, 4321
RsaNI GTAC 9 cut(s) 101, 110, 236, 1124, 1601, 2837, 3245, 3452, 4320
RseI CAYNNNNRTG 7 cut(s) 621, 810, 1974, 2238, 3572, 4187, 4369
SacI GAGCTC 1 cut(s) 2031
SapI GCTCTTC 2 cut(s) 1563, 2954
Sau96I GGNCC 4 cut(s) 2620, 3364, 3802, 4309
ScaI AGTACT 1 cut(s) 3246
SchI GAGTC 6 cut(s) 416, 499, 1826, 1829, 2162, 3979
ScrFI CCNGG 5 cut(s) 88, 890, 1817, 2729, 4197
SduI GDGCHC 5 cut(s) 1875, 2031, 3086, 3701, 4205
SfcI CTRYAG 7 cut(s) 362, 572, 1884, 3020, 4251, 4388, 4407
SfuI TTCGAA 1 cut(s) 1800
SinI GGWCC 3 cut(s) 2620, 3802, 4309
SmiMI CAYNNNNRTG 7 cut(s) 621, 810, 1974, 2238, 3572, 4187, 4369
SpeI ACTAGT 2 cut(s) 2267, 4205
SphI GCATGC 1 cut(s) 2265
SseBI AGGCCT 1 cut(s) 825
SspI AATATT 1 cut(s) 3787
SstI GAGCTC 1 cut(s) 2031
StuI AGGCCT 1 cut(s) 825
StyD4I CCNGG 5 cut(s) 86, 888, 1815, 2727, 4195
StyI CCWWGG 4 cut(s) 537, 687, 1608, 2640
TaiI ACGT 4 cut(s) 1183, 2544, 3843, 4275
TaqI TCGA 8 cut(s) 267, 312, 1176, 1800, 1992, 3178, 4064, 4344
TatI WGTACW 6 cut(s) 100, 109, 235, 1600, 3244, 4319
TauI GCSGC 6 cut(s) 818, 2704, 3917, 4262, 4377, 4401
TspGWI ACGGA 1 cut(s) 2051
Tth111I GACNNNGTC 1 cut(s) 4340
Vha464I CTTAAG 3 cut(s) 655, 3061, 3676
VneI GTGCAC 3 cut(s) 1871, 3082, 3697
VpaK11BI GGWCC 3 cut(s) 2620, 3802, 4309
XbaI TCTAGA 2 cut(s) 976, 1732
XceI RCATGY 3 cut(s) 14, 274, 2265
XcmI CCANNNNNNNNNTGG 2 cut(s) 3094, 3709
XmiI GTMKAC 1 cut(s) 1250
XmnI GAANNNNTTC 1 cut(s) 1751
ZraI GACGTC 1 cut(s) 3841
ZrmI AGTACT 1 cut(s) 3246
Zsp2I ATGCAT 1 cut(s) 618
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.