Rmu_sc0000061.1_g000021

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000061.1
Physical Location & Seq
Reverse (-)
88887 .. 98521
9635 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000061.1_g000021.1.cds

Sequence Viewer

Length: 7683 bp
atggacaaggacaagagccgtaccgatctgctcgctgctggccgtaaaaagcttcaacaatttcgtcagaagaaggacaaaggcagtggaagccagggaaaatccacgaaaaagtctggaagatcagagcagcatggggctgtagctgatacagtctcaactgcaactaaacctgcagcgtccatcaagtctggaaaatcagagcagcatgaggctgttgctgatgcggtctcaactgcaactaaacccacagcatcgtctcacgtccgtgacggagaaattaagtctgctgtaggttctaattcaggaactgtcgacacatcagagtcaaattctgtagagaattctgcatactctgacactagtgtagctgttgctggtccctcggcagtgctcattacacaggagaaaagtgtggttgaaaccgaattgggggaaaatgccgaatcaccatcagaggaggtgggggttagtaagcgtgatgctgactcttctgttcagattgaaggtgagagtactgggactgctgatgctgaggtggcaagagacagttcattggacacttcacatacagtggattctgggggagaagccaagaattcaaagatgtctatacaggttgatgtatcagcgcaacatccttcagttgatattacagatgggatgtccgttactgttgaatcagagattccaagtagggaaaaggagtcattgccttcagtggaaaatattaatacatccttattgcaggagagggaagatcatgtaacagatgaagaattacagcagttaaatcccttgtctctccagcgtgaaagtgaaatcattgttccaagggaaagtttagctgttgttggtccctcggcagtgctcattacacaggagaaaagtgtggttgaaaccgaattggagaaaaatgccgaattgtcatcagaggaagtgggggttagtaagcgtgatgctgactcttctgttcagaatgaaggtgagagtactgggactgctgatgctgagatggcaagagacaacttattgggcacttcacatatagtggattctggaggagaagccgaaaattcaaatgtgtctatacaggttgatgaatcggcccaacatgcttcagtcgatattacagaggggatgtccatcactgttgaatcagatattccgagtagggaaaaggagtcaatgccttcacgggaaaatattaatacatccttaatgcaggagagggaagatcaggaagaagtacagcagttaaatgccttgtctctccagccttgtctctcaactgcaactaaacctacagcattgtctcgggtctctgacggagaaattaagtctgttgtgggttctaattcaggaattgtcaacacatcagagtcaaattctgtagagaattctgcagactctgacactagagtagctgttgctggtccctcagcagtgcccattacacaggagaaaagtgtggttgaaactgaattggagaaaaatgccgaatcaccatcagaggaagtgggggttagtaagcgtgatgctgactcctctgttcagaatgaaggtgagagtactaggactgctgatgctgaggtggcaagaggcatttcattggacacttcacatacagtggattctggaggggaagccaagaattcaaagatgtctatacaggttgaagtatcagcgcaacatgcttctgataatattacagaggggatgtctgttattgttgaatcagagattccaagtagtgaagaggagtcattgccttcacaggacaatattaatacatccttaatgcaggagagggaagatcaggaagaagtacagcagttaaattccttgtctctggggaatgctgatgccacctctggggaattgaaagatcagaatgaggccttagaagaatatagcaagaaactggaagcaacaaatattgagctcagggtcctatatgaagctttagaagaacataggggaagcattgaatctaggaactgtgagctttcgattctctgtgaatccttacaactagaagtcactaatcttaaagtagaaaacatggaagttgacagaaaactacatgtgtatgaggccacctctggggagttgaaggatcggaatgaggccttagaagaatatagcaagaaactggaagcaacgaacattgagctcagggtcctatatgaagctttagaagaacataggggaaggattgaatctaggaactgtgagctttcgattctttgcgaatccttacaactagaagtcactaatcttaaagtagaaaacgtggaagttgacagaaagctacatgtgtatgaatcaagaactagtaaattgcagagtcaattgcatgatctatatctaatttcaaatgttatggtatctcagatctctgagcagttggaaaattttcacaaggaagcagctgagaaagttttgatacttgagcgccattggaattcaactattgatccggttcttgaagcaactgggaagcttgatgaatctcttggtagggtcaacatgactactgcagtctctcataattctttggacagaataagctattctgttgcttctgtttatgatgccatcagttttattcaagatctgaaggacaaacttgaaagttctcaaacagaacatgaagcagtctttactttatacaaagaagtgaatgagaaatgtgatgatctgcatggaaagtatcaaatggctagtgatttgttgcagaagttgtatggcgacctttctaaacttctcacggttttgcatgggtctacagatgaaagtgatatgtacttagaacctgagaagcttcctgatcctctagattacagtaattatgagatcatcatagaacatgtggaatcttttttgagggggagtctgcaacttgaatctgttaacaagaaactaaattcagagttgatggctagcgctgaagaagttgaggaactgaaacaaagatgccttgattctaatgttctgcagaagttaatagaaaatgttgaaggggtgctgaaagtggatcatgctgagtttcaattggataaaacacctgcttcacgtcttgaatcactggtgtcatgtcttgttcagaaatgcgaggaggctgacgtgcagctaagcttatctaaggaagattctggatctaaggtggtggagctgactttaatgcaggaagaagtacaccagttaaatgccttgtctctccagcatgaaagtgaactcattgttctaagggaaagtttacatcaggcggaggaagcacttcttgttgctcgttctgagatagaagggaaagtaaatgaacttgaacagtcagagcaacgggtgtcttcccttagagagaagcttaccattgctgtcaccaaggggaaaggtttgattgtgcagcgagatggtctgaagcagtcccttaacgagaaatctgttgaactggaaagattctcacaggaactgcaaatgaaagatgcaaggcttcttgagattgaaacaaaacttaaggcatattcagagtcaggtgagcgggtggaagctctggaatctgagctttcatatattcgcaattcggctactgcattaagagaatcattccttctcaaagattctgtccttcagagaatagaagagatcttggaagaccttgatctgccagagcattttcattcaagagatattattgagaagattgattggctggctaggacagctaccagtaacacttttcctgtgactgattcagatcagaagagttctgccggtggagttttgtactctgatgctggttttgttgttatggattcctggaaagatgatgtagaaccaagttcaaattcaagtgaggatatcaaaagaaaatatgacgagcttcagagtaaattttatgggttggctgaacagaatgaaatgttggagcaatctttaatggaaaggaacaatatagtacagagatgggaggaaattttggacagaatcgacatgccatcacatctgcgatctgtggagccagaggataggatcgattggttaagtaaagcactttcagaagtgcaggaagacaatatgtctctccagcagaaggttgttaaccttgaaaaccattgtgtatcactaactgctgatttggaagactcgcaaaggagagtgtctgaccttggggcagaccttcaaacacttgtccatgagagagatcatctttctgaaagattggagactctggtcaatgatcaggagaagctttcaacaaaggcagttgaatttgagcttgagaatgaaaagctgcagaaggaagccactgttttgcaagaaaatgtagccaagatgcatggaaatgagaatcaaattctcagcatagaagctgacttaagaagattacagagtttggttactgatgccttggaggtctctggatcaaagtatgagtattctggtgatagtagcattgagtgcttggaagggtcactgaataagcttttagagagttatgcaactctttcctcaggaaaacctatagaagctgacttaagaagattacagagtttggttactgatgccttggaggtctctggatcaaagtatgagtactccggtgatagtagcattgagtgcttagaagggttactgaataagcttttagagagttatgcaactctttcctcaggaaaacctgtgcatgggggtgcagctgaaggtctccatactgaatatactgatgcaacagttgttggatcgagaagcctaaatagacttgattcccaggaatcagatatagatgttttgaagaaagagttggaggatgttcaacatgaacttttagatgtgaaggaggagagggatggatatctagagaagcaacagtctatggccagtgaatttgaagcattacataacaaagtgaatgagttgcaagggctgcttaatcaagaggagaagaagtcagcttctgttagagacaagttaaatgttgcagtcagaaaagggaagtctttggtacaacagcgtgacagtctgaaacaaagtattgatgaggtcaactctgaggtggaacatttgagatcagagatcaagacagggcaagttaaaattgcagagtatgaacaaaaggtcagggatttgtctacttaccctggtagggtagaggccttagaatctgagacattgttcttgaggaattgtttgaatgaaactgagcagaatttgcagcagaaagcaaatactttgagcatgattgtaaatatcttagacaacattgatggaggcgattttaattctcgtgatccagttgtgaagttggaacaaattgggaaaatgtgctttgatttacgcacagatgttgcttcttctgagcaagagactaggaaatccaaaagagcagcagagctactccttgcagaactgaatgaggttcaagagaggaatgactgtctccaggaagagctagcaaaatctgctgatgaaatttctatactctccaaggaaagggatcttgctgaggctggcaagcttaaagctgttttaagtcttgaaaagttatctactgctcactccgaggaaagaaaccaattttctgaatttgcaggactgaaatctggtgtagatcaactcaggaagggtttccatgatattagcaattcattggctggtcttttttacaacgacttggaatatttgaaaaacttggagtctggtattgactcatgtctcaacttgaatagtgctaatgtggttgatgtgcaccccttcactgcagctggtggatttctattgagcaaatcagataaggataactctatttcaattaattctcagtcagaccccgaggcgcatggacattttagtgacggttttgccatcgaaacctttacatacataacacattatgtgcaagagctcatgacagagattggtgtgcttaaagaaaaattagatgaacactcaatgtctttgcatgaaaaatctagcagtgtatccggattggtggcaattgttcgtggagagataagttccaaaaatgagtcgtttgaagccttgaggagagactttttgcagatggaaatggtcaaaaaagaaaaggacaaggaacttcttgtcttgcatagaaatgctgccttgctttttgaagcatgcactagttcagttgtggaaataaatagaagaaaagctgaattggtgggaaatagttgggctgttggagatctgggaatgacatcaaaaacagcagaattgcccgctttcaggggagagggtgagctgtactctgaggaatctgttaggtctgtggcagacaggcttttgtcggctgctagtgattttgctactctgacagctgaaatagttgaaggcagccaaaaggaaatgaagcttaccatttcaaatttgcagaaagagcttcaggagaaggacgttcaaaaggagaggattttcatggagcttgtaagtcaaatcaaggaggctgaagctactgcaagcagctattcagtggaccttgaatcttcaaaaaccttggtgcacgatttggagaaacagttggaagcgatgaaaggtgaacgcaacctacttgagcagagagtaaaggagctagaagatggccatgcctcctctgacgagttacaacagagggtcagatctctaacggatgtgcttgctgccaaagaccatgaaattgagcagctaattcaagcacttgatgaggaggaggtacagatgcaaggtatcaccttcaagatcaaggaactggaaaagattgttgaacaaaaaaacctagatttagagaaccttgaagcttctcgtggcaaggtgatgaaaaagctcttcgtcactgtgaataagtttgacgagctgcatcatctatctgcaagcctcctagcggaagttgaagaactgcagtcacagttgcaagatcgggatgcagagatttctttcttaaggcaagaggtcactaggtgcaccaatgatgttctggttgcatcacaagtcagtaagaagggaaattcagatgagatccacgagttattaacatggtttgatatgaatgttgctcgatttggggtgcgcagtgagtatcttgaagataagaacaacagtgacatcgctgaacaaatggaagtactcaagaagacagttgattctattttatcagaattgggggatctacgggctgctgctcaaagcaaagatatattgttgcaagaagaaaggactaaggtagaagaattagcacgcaagggtcagactcttgagaagtgtttgcgggagaaggaatcacaattaaatctgcttgaaggtgtggaagacggccaggcaactagcttgacctcggagattcatgaagttgagcctgcgataaacaaatgggcagcatctggttcctcccttgcatcgcaagtccgcagtttgcgcaaaggcaatagtgagcaagttgcaattgccatagatatggatcctgggagcactagtagattggaagatgaagaagatgataaggttcatggtttcaagtcactcactacatcaagaatggttcctagatttacaagacctctgactgacatggttgatggcctctgggttacgtgtgatcggactttaatgcgacaaccaattttgcggcttggtatcatattctattgggcctttctgcatgcgcttctagctagtcttgcaatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

2560

Amino Acids

284.45

Weight (kDa)

4.67

Isoelectric Point (pI)

49.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 3079
Acc16I TGCGCA 2 cut(s) 7067, 7412
Acc36I ACCTGC 2 cut(s) 181, 3079
AccBSI CCGCTC 1 cut(s) 3541
AccI GTMKAC 3 cut(s) 315, 2789, 5132
AccIII TCCGGA 1 cut(s) 5984
AciI CCGC 8 cut(s) 227, 3272, 3541, 6243, 6881, 7264, 7402, 7621
AcoI YGGCCR 4 cut(s) 40, 4878, 6601, 7309
AdeI CACNNNGTG 1 cut(s) 6957
AfeI AGCGCT 1 cut(s) 2950
AfiI CCNNNNNNNGG 9 cut(s) 432, 1875, 2106, 4093, 4688, 5146, 5493, 6249, 6880
AflII CTTAAG 4 cut(s) 3515, 4378, 4537, 6937
AflIII ACRYGT 4 cut(s) 2086, 2317, 2872, 7586
AhdI GACNNNNNGTC 1 cut(s) 4078
AhlI ACTAGT 4 cut(s) 362, 2336, 6143, 7466
AjiI CACGTC 3 cut(s) 265, 3080, 3130
AjnI CCWGG 7 cut(s) 93, 3818, 4770, 5140, 5442, 7311, 7456
AjuI GAANNNNNNNTTGG 6 cut(s) 3832, 3864, 3908, 3940, 4787, 4819
AleI CACNNNNGTG 1 cut(s) 267
Alw21I GWGCWC 9 cut(s) 396, 873, 1947, 2178, 5751, 5907, 6525, 6962, 7466
Alw44I GTGCAC 3 cut(s) 5747, 6521, 6958
AlwNI CAGNNNCTG 5 cut(s) 311, 1412, 3472, 4958, 7376
Ama87I CYCGRG 2 cut(s) 1317, 5831
Aor13HI TCCGGA 1 cut(s) 5984
Aor51HI AGCGCT 1 cut(s) 2950
ApaLI GTGCAC 3 cut(s) 5747, 6521, 6958
ArsI GACNNNNNNTTYG 2 cut(s) 3609, 3641
AseI ATTAAT 4 cut(s) 732, 1209, 1788, 5814
Asp700I GAANNNNTTC 3 cut(s) 2418, 3282, 5627
AspLEI GCGC 8 cut(s) 634, 1690, 2460, 2951, 5839, 7068, 7413, 7660
AspS9I GGNCC 8 cut(s) 380, 857, 1108, 1436, 1951, 2182, 6496, 7644
AsuNHI GCTAGC 2 cut(s) 2945, 5452
AvaI CYCGRG 2 cut(s) 1317, 5831
AvaII GGWCC 6 cut(s) 380, 857, 1436, 1951, 2182, 6496
AxyI CCTNAGG 2 cut(s) 4513, 4672
BaeGI GKGCMC 5 cut(s) 1040, 1452, 5751, 6525, 6962
BalI TGGCCA 2 cut(s) 4880, 6603
BamHI GGATCC 1 cut(s) 7453
BanII GRGCYC 3 cut(s) 1947, 2178, 5907
BauI CACGAG 3 cut(s) 5286, 6801, 7019
BbsI GAAGAC 6 cut(s) 3342, 3660, 4077, 4149, 7136, 7311
Bbv12I GWGCWC 9 cut(s) 396, 873, 1947, 2178, 5751, 5907, 6525, 6962, 7466
BbvCI CCTCAGC 4 cut(s) 534, 1441, 1590, 5505
BceAI ACGGC 3 cut(s) 3, 27, 7324
BciT130I CCWGG 7 cut(s) 95, 3820, 4772, 5142, 5444, 7313, 7458
BciVI GTATCC 1 cut(s) 5992
BclI TGATCA 1 cut(s) 4240
BcuI ACTAGT 4 cut(s) 362, 2336, 6143, 7466
BfoI RGCGCY 2 cut(s) 2461, 2952
BfrI CTTAAG 4 cut(s) 3515, 4378, 4537, 6937
BfuAI ACCTGC 2 cut(s) 181, 3079
BfuI GTATCC 1 cut(s) 5992
BglII AGATCT 5 cut(s) 2397, 2617, 3645, 6208, 6638
BlpI GCTNAGC 1 cut(s) 3137
BmcAI AGTACT 5 cut(s) 517, 994, 1573, 4598, 7122
Bme1390I CCNGG 7 cut(s) 95, 3820, 4772, 5142, 5444, 7313, 7458
Bme18I GGWCC 6 cut(s) 380, 857, 1436, 1951, 2182, 6496
BmeRI GACNNNNNGTC 1 cut(s) 4078
BmeT110I CYCGRG 2 cut(s) 1317, 5831
BmgBI CACGTC 3 cut(s) 265, 3080, 3130
BmgT120I GGNCC 8 cut(s) 380, 857, 1108, 1436, 1951, 2182, 6496, 7644
BmiI GGNNCC 9 cut(s) 382, 859, 1438, 1952, 2183, 4020, 7381, 7455, 7536
BmrFI CCNGG 7 cut(s) 95, 3820, 4772, 5142, 5444, 7313, 7458
BmrI ACTGGG 3 cut(s) 528, 1005, 2508
BmtI GCTAGC 2 cut(s) 2949, 5456
BmuI ACTGGG 3 cut(s) 528, 1005, 2508
BoxI GACNNNNGTC 2 cut(s) 4232, 5712
BpiI GAAGAC 6 cut(s) 3342, 3660, 4077, 4149, 7136, 7311
BplI GAGNNNNNCTC 6 cut(s) 2087, 2119, 5033, 5065, 6254, 6286
BpmI CTGGAG 7 cut(s) 791, 1080, 1259, 1659, 3209, 4070, 5426
Bpu10I CCTNAGC 6 cut(s) 534, 1441, 1590, 1946, 2177, 5505
Bpu1102I GCTNAGC 1 cut(s) 3137
BpuEI CTTGAG 8 cut(s) 2474, 3518, 4301, 5200, 6064, 6593, 7109, 7271
Bsa29I ATCGAT 1 cut(s) 4035
BsaAI YACGTR 1 cut(s) 7587
BsaBI GATNNNNATC 5 cut(s) 1145, 2367, 3756, 4854, 7452
BsaI GGTCTC 5 cut(s) 235, 1327, 4423, 4582, 4712
BsaWI WCCGGW 3 cut(s) 2482, 4601, 5984
BsaXI ACNNNNNCTCC 6 cut(s) 4934, 4964, 6524, 6554, 7453, 7483
Bsc4I CCNNNNNNNGG 9 cut(s) 432, 1875, 2106, 4093, 4688, 5146, 5493, 6249, 6880
Bse118I RCCGGY 1 cut(s) 3773
Bse21I CCTNAGG 2 cut(s) 4513, 4672
Bse3DI GCAATG 3 cut(s) 710, 1766, 3372
Bse8I GATNNNNATC 5 cut(s) 1145, 2367, 3756, 4854, 7452
BseAI TCCGGA 1 cut(s) 5984
BseBI CCWGG 7 cut(s) 95, 3820, 4772, 5142, 5444, 7313, 7458
BseCI ATCGAT 1 cut(s) 4035
BseJI GATNNNNATC 5 cut(s) 1145, 2367, 3756, 4854, 7452
BseLI CCNNNNNNNGG 9 cut(s) 432, 1875, 2106, 4093, 4688, 5146, 5493, 6249, 6880
BseMI GCAATG 3 cut(s) 710, 1766, 3372
BseSI GKGCMC 5 cut(s) 1040, 1452, 5751, 6525, 6962
BsgI GTGCAG 4 cut(s) 3152, 3425, 4085, 4716
BshVI ATCGAT 1 cut(s) 4035
BsiHKAI GWGCWC 9 cut(s) 396, 873, 1947, 2178, 5751, 5907, 6525, 6962, 7466
BsiHKCI CYCGRG 2 cut(s) 1317, 5831
BsiSI CCGG 4 cut(s) 2483, 3774, 4602, 5985
BslFI GGGAC 6 cut(s) 366, 535, 843, 1012, 1422, 3412
BslI CCNNNNNNNGG 9 cut(s) 432, 1875, 2106, 4093, 4688, 5146, 5493, 6249, 6880
BsmBI CGTCTC 1 cut(s) 264
BsmFI GGGAC 6 cut(s) 366, 535, 843, 1012, 1422, 3412
BsmI GAATGC 1 cut(s) 1864
Bso31I GGTCTC 5 cut(s) 235, 1327, 4423, 4582, 4712
BsoBI CYCGRG 2 cut(s) 1317, 5831
Bsp13I TCCGGA 1 cut(s) 5984
Bsp1720I GCTNAGC 1 cut(s) 3137
BspACI CCGC 8 cut(s) 227, 3272, 3541, 6243, 6881, 7264, 7402, 7621
BspDI ATCGAT 1 cut(s) 4035
BspEI TCCGGA 1 cut(s) 5984
BspHI TCATGA 2 cut(s) 5907, 7339
BspLI GGNNCC 9 cut(s) 382, 859, 1438, 1952, 2183, 4020, 7381, 7455, 7536
BspMAI CTGCAG 7 cut(s) 178, 1408, 2545, 3003, 4299, 5764, 6900
BspMI ACCTGC 2 cut(s) 181, 3079
BspOI GCTAGC 2 cut(s) 2949, 5456
BspQI GCTCTTC 2 cut(s) 5442, 6830
BspTI CTTAAG 4 cut(s) 3515, 4378, 4537, 6937
BspTNI GGTCTC 5 cut(s) 235, 1327, 4423, 4582, 4712
BsrBI CCGCTC 1 cut(s) 3541
BsrDI GCAATG 3 cut(s) 710, 1766, 3372
BsrFI RCCGGY 1 cut(s) 3773
BssAI RCCGGY 1 cut(s) 3773
BssSI CACGAG 3 cut(s) 5286, 6801, 7019
BssT1I CCWWGG 7 cut(s) 833, 3384, 4168, 4410, 4569, 5487, 6516
Bst2BI CACGAG 3 cut(s) 5286, 6801, 7019
Bst2UI CCWGG 7 cut(s) 95, 3820, 4772, 5142, 5444, 7313, 7458
Bst6I CTCTTC 7 cut(s) 496, 973, 1752, 3636, 3758, 5442, 6830
BstAFI CTTAAG 4 cut(s) 3515, 4378, 4537, 6937
BstAPI GCANNNNNTGC 5 cut(s) 4461, 4620, 4927, 5212, 5462
BstBAI YACGTR 1 cut(s) 7587
BstH2I RGCGCY 2 cut(s) 2461, 2952
BstHHI GCGC 8 cut(s) 634, 1690, 2460, 2951, 5839, 7068, 7413, 7660
BstNI CCWGG 7 cut(s) 95, 3820, 4772, 5142, 5444, 7313, 7458
BstNSI RCATGY 8 cut(s) 1118, 1697, 2090, 2321, 2876, 3997, 6141, 7658
BstPAI GACNNNNGTC 2 cut(s) 4232, 5712
BstSCI CCNGG 7 cut(s) 93, 3818, 4770, 5140, 5442, 7311, 7456
BstSLI GKGCMC 5 cut(s) 1040, 1452, 5751, 6525, 6962
BstV2I GAAGAC 6 cut(s) 3342, 3660, 4077, 4149, 7136, 7311
BstXI CCANNNNNNTGG 1 cut(s) 7450
Bsu15I ATCGAT 1 cut(s) 4035
Bsu36I CCTNAGG 2 cut(s) 4513, 4672
BsuI GTATCC 1 cut(s) 5992
BsuTUI ATCGAT 1 cut(s) 4035
BtgZI GCGATG 3 cut(s) 6563, 7087, 7377
BtrI CACGTC 3 cut(s) 265, 3080, 3130
BtsI GCAGTG 7 cut(s) 91, 396, 873, 1452, 5757, 5983, 7075
BveI ACCTGC 2 cut(s) 181, 3079
CaiI CAGNNNCTG 5 cut(s) 311, 1412, 3472, 4958, 7376
CciI TCATGA 2 cut(s) 5907, 7339
CfoI GCGC 8 cut(s) 634, 1690, 2460, 2951, 5839, 7068, 7413, 7660
Cfr10I RCCGGY 1 cut(s) 3773
Cfr13I GGNCC 8 cut(s) 380, 857, 1108, 1436, 1951, 2182, 6496, 7644
ClaI ATCGAT 1 cut(s) 4035
CseI GACGC 1 cut(s) 168
CspCI CAANNNNNGTGG 2 cut(s) 67, 102
DraIII CACNNNGTG 1 cut(s) 6957
DriI GACNNNNNGTC 1 cut(s) 4078
EaeI YGGCCR 4 cut(s) 40, 4878, 6601, 7309
Eam1104I CTCTTC 7 cut(s) 496, 973, 1752, 3636, 3758, 5442, 6830
Eam1105I GACNNNNNGTC 1 cut(s) 4078
EarI CTCTTC 7 cut(s) 496, 973, 1752, 3636, 3758, 5442, 6830
EciI GGCGGA 1 cut(s) 3287
Ecl136II GAGCTC 3 cut(s) 1945, 2176, 5905
Eco130I CCWWGG 7 cut(s) 833, 3384, 4168, 4410, 4569, 5487, 6516
Eco147I AGGCCT 3 cut(s) 1901, 2132, 5156
Eco24I GRGCYC 3 cut(s) 1947, 2178, 5907
Eco31I GGTCTC 5 cut(s) 235, 1327, 4423, 4582, 4712
Eco32I GATATC 2 cut(s) 3862, 4856
Eco47I GGWCC 6 cut(s) 380, 857, 1436, 1951, 2182, 6496
Eco47III AGCGCT 1 cut(s) 2950
Eco53kI GAGCTC 3 cut(s) 1945, 2176, 5905
Eco81I CCTNAGG 2 cut(s) 4513, 4672
Eco88I CYCGRG 2 cut(s) 1317, 5831
EcoICRI GAGCTC 3 cut(s) 1945, 2176, 5905
EcoO109I RGGNCCY 2 cut(s) 1951, 2182
EcoRI GAATTC 5 cut(s) 343, 598, 1399, 1654, 2467
EcoRII CCWGG 7 cut(s) 93, 3818, 4770, 5140, 5442, 7311, 7456
EcoRV GATATC 2 cut(s) 3862, 4856
EcoT14I CCWWGG 7 cut(s) 833, 3384, 4168, 4410, 4569, 5487, 6516
EcoT22I ATGCAT 1 cut(s) 4341
EcoT38I GRGCYC 3 cut(s) 1947, 2178, 5907
ErhI CCWWGG 7 cut(s) 833, 3384, 4168, 4410, 4569, 5487, 6516
Esp3I CGTCTC 1 cut(s) 264
FalI AAGNNNNNCTT 4 cut(s) 3270, 3302, 4914, 4946
FaqI GGGAC 6 cut(s) 366, 535, 843, 1012, 1422, 3412
FauI CCCGC 3 cut(s) 3534, 6250, 7257
FbaI TGATCA 1 cut(s) 4240
FblI GTMKAC 3 cut(s) 315, 2789, 5132
FriOI GRGCYC 3 cut(s) 1947, 2178, 5907
FspI TGCGCA 2 cut(s) 7067, 7412
GlaI GCGC 8 cut(s) 633, 1689, 2459, 2950, 5838, 7067, 7412, 7659
GsuI CTGGAG 7 cut(s) 791, 1080, 1259, 1659, 3209, 4070, 5426
HaeII RGCGCY 2 cut(s) 2461, 2952
HapII CCGG 4 cut(s) 2483, 3774, 4602, 5985
HgaI GACGC 1 cut(s) 168
HhaI GCGC 8 cut(s) 634, 1690, 2460, 2951, 5839, 7068, 7413, 7660
Hin6I GCGC 8 cut(s) 632, 1688, 2458, 2949, 5837, 7066, 7411, 7658
HinP1I GCGC 8 cut(s) 632, 1688, 2458, 2949, 5837, 7066, 7411, 7658
HincII GTYRAC 8 cut(s) 316, 1372, 2074, 2305, 2530, 2917, 4102, 5047
HindII GTYRAC 8 cut(s) 316, 1372, 2074, 2305, 2530, 2917, 4102, 5047
HpaI GTTAAC 2 cut(s) 2917, 4102
HpaII CCGG 4 cut(s) 2483, 3774, 4602, 5985
HpyCH4IV ACGT 6 cut(s) 264, 2295, 3079, 3129, 6417, 7586
HpySE526I ACGT 6 cut(s) 264, 2295, 3079, 3129, 6417, 7586
HspAI GCGC 8 cut(s) 632, 1688, 2458, 2949, 5837, 7066, 7411, 7658
Kpn2I TCCGGA 1 cut(s) 5984
Ksp22I TGATCA 1 cut(s) 4240
KspAI GTTAAC 2 cut(s) 2917, 4102
LguI GCTCTTC 2 cut(s) 5442, 6830
LmnI GCTCC 6 cut(s) 3175, 3928, 4018, 6442, 6589, 7461
MaeII ACGT 6 cut(s) 264, 2295, 3079, 3129, 6417, 7586
MbiI CCGCTC 1 cut(s) 3541
MfeI CAATTG 4 cut(s) 2354, 3056, 5997, 7437
MlsI TGGCCA 2 cut(s) 4880, 6603
MluNI TGGCCA 2 cut(s) 4880, 6603
MmeI TCCRAC 7 cut(s) 2391, 3906, 4720, 4785, 5286, 6184, 6522
Mox20I TGGCCA 2 cut(s) 4880, 6603
Mph1103I ATGCAT 1 cut(s) 4341
MroI TCCGGA 1 cut(s) 5984
MroXI GAANNNNTTC 3 cut(s) 2418, 3282, 5627
MscI TGGCCA 2 cut(s) 4880, 6603
MslI CAYNNNNRTG 9 cut(s) 267, 2091, 2322, 3234, 4344, 4692, 5850, 6114, 7448
Msp20I TGGCCA 2 cut(s) 4880, 6603
MspA1I CMGCKG 4 cut(s) 2435, 4700, 5765, 6341
MspCI CTTAAG 4 cut(s) 3515, 4378, 4537, 6937
MspI CCGG 4 cut(s) 2483, 3774, 4602, 5985
MspR9I CCNGG 7 cut(s) 95, 3820, 4772, 5142, 5444, 7313, 7458
MunI CAATTG 4 cut(s) 2354, 3056, 5997, 7437
Mva1269I GAATGC 1 cut(s) 1864
MvaI CCWGG 7 cut(s) 95, 3820, 4772, 5142, 5444, 7313, 7458
NheI GCTAGC 2 cut(s) 2945, 5452
NlaIV GGNNCC 9 cut(s) 382, 859, 1438, 1952, 2183, 4020, 7381, 7455, 7536
NmeAIII GCCGAG 2 cut(s) 365, 842
NsbI TGCGCA 2 cut(s) 7067, 7412
NsiI ATGCAT 1 cut(s) 4341
NspI RCATGY 8 cut(s) 1118, 1697, 2090, 2321, 2876, 3997, 6141, 7658
OliI CACNNNNGTG 1 cut(s) 267
PaeI GCATGC 2 cut(s) 6141, 7658
PagI TCATGA 2 cut(s) 5907, 7339
PaqCI CACCTGC 1 cut(s) 3079
PceI AGGCCT 3 cut(s) 1901, 2132, 5156
PciI ACATGT 3 cut(s) 2086, 2317, 2872
PciSI GCTCTTC 2 cut(s) 5442, 6830
PctI GAATGC 1 cut(s) 1864
PdmI GAANNNNTTC 3 cut(s) 2418, 3282, 5627
PfoI TCCNGGA 2 cut(s) 3818, 5442
Ppu21I YACGTR 1 cut(s) 7587
PpuMI RGGWCCY 2 cut(s) 1951, 2182
PscI ACATGT 3 cut(s) 2086, 2317, 2872
PshAI GACNNNNGTC 2 cut(s) 4232, 5712
PshBI ATTAAT 4 cut(s) 732, 1209, 1788, 5814
Psp124BI GAGCTC 3 cut(s) 1947, 2178, 5907
Psp5II RGGWCCY 2 cut(s) 1951, 2182
Psp6I CCWGG 7 cut(s) 93, 3818, 4770, 5140, 5442, 7311, 7456
PspGI CCWGG 7 cut(s) 93, 3818, 4770, 5140, 5442, 7311, 7456
PspN4I GGNNCC 9 cut(s) 382, 859, 1438, 1952, 2183, 4020, 7381, 7455, 7536
PspPI GGNCC 8 cut(s) 380, 857, 1108, 1436, 1951, 2182, 6496, 7644
PspPPI RGGWCCY 2 cut(s) 1951, 2182
PsrI GAACNNNNNNTAC 2 cut(s) 6552, 6584
PstI CTGCAG 7 cut(s) 178, 1408, 2545, 3003, 4299, 5764, 6900
PstNI CAGNNNCTG 5 cut(s) 311, 1412, 3472, 4958, 7376
PvuII CAGCTG 4 cut(s) 2435, 4700, 5765, 6341
RseI CAYNNNNRTG 9 cut(s) 267, 2091, 2322, 3234, 4344, 4692, 5850, 6114, 7448
SacI GAGCTC 3 cut(s) 1947, 2178, 5907
SalI GTCGAC 1 cut(s) 314
SapI GCTCTTC 2 cut(s) 5442, 6830
Sau96I GGNCC 8 cut(s) 380, 857, 1108, 1436, 1951, 2182, 6496, 7644
ScaI AGTACT 5 cut(s) 517, 994, 1573, 4598, 7122
ScrFI CCNGG 7 cut(s) 95, 3820, 4772, 5142, 5444, 7313, 7458
SinI GGWCC 6 cut(s) 380, 857, 1436, 1951, 2182, 6496
SmiMI CAYNNNNRTG 9 cut(s) 267, 2091, 2322, 3234, 4344, 4692, 5850, 6114, 7448
SpeI ACTAGT 4 cut(s) 362, 2336, 6143, 7466
SphI GCATGC 2 cut(s) 6141, 7658
SseBI AGGCCT 3 cut(s) 1901, 2132, 5156
SsiI CCGC 8 cut(s) 227, 3272, 3541, 6243, 6881, 7264, 7402, 7621
SspI AATATT 6 cut(s) 730, 1207, 1708, 1786, 1939, 5681
SstI GAGCTC 3 cut(s) 1947, 2178, 5907
StuI AGGCCT 3 cut(s) 1901, 2132, 5156
StyD4I CCNGG 7 cut(s) 93, 3818, 4770, 5140, 5442, 7311, 7456
StyI CCWWGG 7 cut(s) 833, 3384, 4168, 4410, 4569, 5487, 6516
TaiI ACGT 6 cut(s) 267, 2298, 3082, 3132, 6420, 7589
TaqI TCGA 9 cut(s) 315, 1125, 2012, 2243, 3990, 4035, 4745, 5868, 7054
TauI GCSGC 1 cut(s) 7624
TspGWI ACGGA 5 cut(s) 257, 288, 658, 1344, 6662
Vha464I CTTAAG 4 cut(s) 3515, 4378, 4537, 6937
VneI GTGCAC 3 cut(s) 5747, 6521, 6958
VpaK11BI GGWCC 6 cut(s) 380, 857, 1436, 1951, 2182, 6496
VspI ATTAAT 4 cut(s) 732, 1209, 1788, 5814
XbaI TCTAGA 2 cut(s) 2839, 4858
XceI RCATGY 8 cut(s) 1118, 1697, 2090, 2321, 2876, 3997, 6141, 7658
XcmI CCANNNNNNNNNTGG 1 cut(s) 6970
XmiI GTMKAC 3 cut(s) 315, 2789, 5132
XmnI GAANNNNTTC 3 cut(s) 2418, 3282, 5627
ZrmI AGTACT 5 cut(s) 517, 994, 1573, 4598, 7122
Zsp2I ATGCAT 1 cut(s) 4341
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.