Rmu_sc0022119.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022119.1
Physical Location & Seq
Reverse (-)
1 .. 3740
3740 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022119.1_g000001.1.cds

Sequence Viewer

Length: 3045 bp
atgtctgaccttgaggcagaccttcaaagatttatccacaagagagattatctttccgaaagattggagactctggtcaatgataaggagaagctttcaaccaaggcagctgaatttgagcttgagaatgaaaagctgcagaagaaagttactgatttgcaagaaaatgtagccaagatgcatggaaatgagaatcaaattctcagcatagaagctgacttaagaagattacagagtttggttactgatgccttggaggtctctggatcaaagtatgagtattctggtggtagtagcattgagtgcttggaagggttactgaataagcttttagagagttatgcaactctttactcggaaaaacctgtgcatgggggtgccgctgaaggcctccatactgaatatgctgatgcaacagttattggatcaagaagcctaaatacacttggttcccaggaatcagatgtagatgttttaaagaaagagttggaggaggttcaacatgaacttttgggtgtgaaggaggagagggatggatatctagagaaggaacagtctatggctagtgaatttcaagcattacataacaaagtgaatgagttgcaagggctgcttaatcaagaggagcagaagttagcttctgttagagagaagttaaatgttgcagtcagaaaagggaagtcattggtacaacagcgtgacagtctgaaacaaagtattgatgaggtcaattctgaggtcgaacgtttgagatcagagatcaagatggggcaagttaaaattgcagagtatgaacaaaacttcagggatttgtctacttaccctagcagggtagaagccttagaatctgagacattgttcttgaggaattgtttgaatgaaactgagcagaatttgcagcacaaagaaaatactttgagcctgattgtaaatatcttagacaacattgatgtaggaggcgattttaactctcgtgatccagttgtgaagttagaacaaattgggaaaatgtgctttgatctgcgcgctgatgtagcaacttctgagcaagaggctaggaaatccaaaagagcagcagagctactccttgcagaactgaatgaggttcaagagaggaacgatggtctccaagaagagcttgcaaaatctgctgatgaaatttctgtactctccaaggaaagggatcttgctgaggcgagcaaacttgaagctgttttaagtcttgaaaagctatctactgctcactccgaggaaagaaaagaccaattttctgaatttgcaggactgaaatctggtctagatcaactcaggaagggtttccatgatattaacaattcattggccgatattttttacaacgacttcgaatttttgaacaacctggagtctggtattgactcatgtctcaaattaaatagtgctaatgtggttgatgtgcaccccttcactgcagctggtggatttctaacgagcaaatcagataaggataactctatttcaatgaattctaggtcagacaccaatgcgcgtggacattttggtgacagttttgtcatcgaaacctttacatacataacacattatgtgcaagagctcatgacggagattggtgtgcttaaagaaaaattagatgaacactcaatgtctttgcatgaaaaatctagcagtgtatccagattggtggcaattgtttgtggagagataacttccaaaaacgagtcatttgaagccttgaggagagactttttgcagatggaaatggtcaaaaaggaaaaggacaaggaacttgttgtcttgcatagaaatgctgctgtgctttttgaagcatgcactagttcagctgtgaaaataaatagaagaaaagatgaattggtgggaaatagttgggctgttggagatctgggaatgacatcaaaaccaacagaattgcccgctttcagtggagagggtcagctttactctgaggaatctgttaggtctgtggcagacaggcttttgtcggctgctagtgattttgctactctgacagctaaaatagttgaacgcagccaaaaggaaatgaagcttaccatttcaaatttgcagaaagagcttcaggagaaggacgttcaaaaggagaggattttcatggagcttgtaagtcaaatcatggaagctgaagctactgcaagcagctattcagtggaccttgaatcttcaaaaaccttggtgcatgatttggagaaacagttggaagcgatgaaaggtgaacgcaacttatttgagcggcgagtaaaggagctagaagatggccaggccacctctgccgatttacaacagagggtcagaacactaactgatgtgcttgctgccaaagaccatgaaattgagaagctgatgcaagcacttgatgaggaggaggtacagatgcaaggtatcaccttcaagatcaaggaactggaaaagattgtggaacaaaagaacctagatttagagaaccttgaagcttctcgtgggaaggttatgaaaaagctctccatcactgtatataagtttgacgagctgcatcacctatctgcaagcctccttgcggaagttgaaaaattgcagtcacaattgcaagatcgggatgcagagatttctttcttaaggcgagaggtcactaggtgcaccaatgatgttctggttgcatcacaagtcagtaagaagggaaattctgatgagatccacgagttattaacatggtttgatatgaatattgctgcatttggggtccacagtgagtatcttgaaaataagaacaacagtgacgtccctgaacaaaaggaagtattcaagaagacagttgattcaattttatcagaattaggggatctacgggctgcggctcaaagcaaagatatattgttgcaagaagaaaggactaaggtagaagaattaacacacaagggtcagactcttgaggagtgtttacgggagaaggaatcacgattaaatctgcttgaaggtgtggaagacggccaagcaactagctcgacctcagagattcatgaagttgagcctgcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

1015

Amino Acids

114.5

Weight (kDa)

4.89

Isoelectric Point (pI)

48.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 1550
AatII GACGTC 1 cut(s) 2793
AccB1I GGYRCC 1 cut(s) 377
AccBSI CCGCTC 1 cut(s) 2266
AccI GTMKAC 1 cut(s) 815
AccII CGCG 2 cut(s) 1026, 1528
AciI CCGC 5 cut(s) 381, 1932, 2266, 2570, 2864
AclI AACGTT 1 cut(s) 745
AclWI GGATC 6 cut(s) 274, 433, 971, 1191, 2698, 2859
AcoI YGGCCR 3 cut(s) 1341, 2290, 2998
AcuI CTGAAG 4 cut(s) 405, 787, 2078, 2178
AcyI GRCGYC 1 cut(s) 2790
AdeI CACNNNGTG 1 cut(s) 2646
AfaI GTAC 3 cut(s) 690, 1167, 2403
AfiI CCNNNNNNNGG 4 cut(s) 371, 829, 1179, 2569
AflII CTTAAG 2 cut(s) 220, 2626
AhlI ACTAGT 1 cut(s) 1832
AjnI CCWGG 3 cut(s) 453, 1380, 2292
Alw21I GWGCWC 3 cut(s) 1440, 1596, 2651
Alw26I GTCTC 6 cut(s) 62, 265, 845, 1130, 1409, 1734
Alw44I GTGCAC 2 cut(s) 1436, 2647
AlwI GGATC 6 cut(s) 274, 433, 971, 1191, 2698, 2859
AoxI GGCC 5 cut(s) 388, 1341, 2290, 2295, 2998
ApaLI GTGCAC 2 cut(s) 1436, 2647
Asp700I GAANNNNTTC 1 cut(s) 1316
AspLEI GCGC 3 cut(s) 1026, 1028, 1528
AspS9I GGNCC 2 cut(s) 2185, 2752
AsuHPI GGTGA 4 cut(s) 1553, 2258, 2410, 2540
AsuII TTCGAA 1 cut(s) 1365
AvaII GGWCC 2 cut(s) 2185, 2752
BaeGI GKGCMC 2 cut(s) 1440, 2651
BalI TGGCCA 1 cut(s) 2292
BanI GGYRCC 1 cut(s) 377
BanII GRGCYC 1 cut(s) 1596
BarI GAAGNNNNNNTAC 2 cut(s) 424, 456
BauI CACGAG 3 cut(s) 972, 2490, 2708
BbsI GAAGAC 2 cut(s) 2825, 3000
Bbv12I GWGCWC 3 cut(s) 1440, 1596, 2651
BbvCI CCTCAGC 1 cut(s) 1191
BccI CCATC 6 cut(s) 527, 760, 1115, 1747, 2282, 2525
BceAI ACGGC 1 cut(s) 3013
BcgI CGANNNNNNTGC 2 cut(s) 2994, 3028
BciT130I CCWGG 3 cut(s) 455, 1382, 2294
BciVI GTATCC 1 cut(s) 1681
BcoDI GTCTC 6 cut(s) 62, 265, 845, 1130, 1409, 1734
BcuI ACTAGT 1 cut(s) 1832
BfmI CTRYAG 2 cut(s) 137, 1449
BfrI CTTAAG 2 cut(s) 220, 2626
BfuI GTATCC 1 cut(s) 1681
BglII AGATCT 1 cut(s) 1897
Bme1390I CCNGG 3 cut(s) 455, 1382, 2294
Bme18I GGWCC 2 cut(s) 2185, 2752
BmgT120I GGNCC 2 cut(s) 2185, 2752
BmiI GGNNCC 3 cut(s) 379, 451, 2753
BmrFI CCNGG 3 cut(s) 455, 1382, 2294
BmsI GCATC 8 cut(s) 168, 238, 400, 2367, 2397, 2554, 2599, 2678
BoxI GACNNNNGTC 2 cut(s) 74, 1401
BpiI GAAGAC 2 cut(s) 2825, 3000
BpmI CTGGAG 1 cut(s) 1403
Bpu10I CCTNAGC 1 cut(s) 1191
Bpu14I TTCGAA 1 cut(s) 1365
BpuEI CTTGAG 5 cut(s) 32, 143, 883, 1753, 2960
BsaBI GATNNNNATC 1 cut(s) 537
BsaHI GRCGYC 1 cut(s) 2790
BsaI GGTCTC 2 cut(s) 265, 1130
BsaJI CCNNGG 6 cut(s) 102, 252, 453, 1173, 1248, 2205
BsaXI ACNNNNNCTCC 4 cut(s) 617, 647, 2213, 2243
Bsc4I CCNNNNNNNGG 4 cut(s) 371, 829, 1179, 2569
Bse1I ACTGG 2 cut(s) 980, 2442
Bse8I GATNNNNATC 1 cut(s) 537
BseBI CCWGG 3 cut(s) 455, 1382, 2294
BseDI CCNNGG 6 cut(s) 102, 252, 453, 1173, 1248, 2205
BseGI GGATG 2 cut(s) 538, 2614
BseJI GATNNNNATC 1 cut(s) 537
BseLI CCNNNNNNNGG 4 cut(s) 371, 829, 1179, 2569
BseMII CTCAG 9 cut(s) 217, 726, 840, 876, 1035, 1182, 1321, 1953, 3033
BseNI ACTGG 2 cut(s) 980, 2442
BsePI GCGCGC 1 cut(s) 1024
BseRI GAGGAG 7 cut(s) 506, 539, 638, 1750, 2408, 2411, 2957
BseSI GKGCMC 2 cut(s) 1440, 2651
Bsh1236I CGCG 2 cut(s) 1026, 1528
BshFI GGCC 5 cut(s) 390, 1343, 2292, 2297, 3000
BshNI GGYRCC 1 cut(s) 377
BsiHKAI GWGCWC 3 cut(s) 1440, 1596, 2651
BslFI GGGAC 1 cut(s) 2777
BslI CCNNNNNNNGG 4 cut(s) 371, 829, 1179, 2569
BsmAI GTCTC 6 cut(s) 62, 265, 845, 1130, 1409, 1734
BsmFI GGGAC 1 cut(s) 2777
BsnI GGCC 5 cut(s) 390, 1343, 2292, 2297, 3000
Bso31I GGTCTC 2 cut(s) 265, 1130
Bsp119I TTCGAA 1 cut(s) 1365
Bsp1286I GDGCHC 3 cut(s) 1440, 1596, 2651
BspACI CCGC 5 cut(s) 381, 1932, 2266, 2570, 2864
BspANI GGCC 5 cut(s) 390, 1343, 2292, 2297, 3000
BspCNI CTCAG 9 cut(s) 216, 727, 841, 877, 1036, 1183, 1320, 1954, 3032
BspFNI CGCG 2 cut(s) 1026, 1528
BspHI TCATGA 2 cut(s) 1596, 3028
BspLI GGNNCC 3 cut(s) 379, 451, 2753
BspMAI CTGCAG 2 cut(s) 141, 1453
BspPI GGATC 6 cut(s) 274, 433, 971, 1191, 2698, 2859
BspQI GCTCTTC 1 cut(s) 1128
BspT104I TTCGAA 1 cut(s) 1365
BspT107I GGYRCC 1 cut(s) 377
BspTI CTTAAG 2 cut(s) 220, 2626
BspTNI GGTCTC 2 cut(s) 265, 1130
BsrBI CCGCTC 1 cut(s) 2266
BsrI ACTGG 2 cut(s) 980, 2442
BssECI CCNNGG 6 cut(s) 102, 252, 453, 1173, 1248, 2205
BssHII GCGCGC 1 cut(s) 1024
BssNI GRCGYC 1 cut(s) 2790
BssSI CACGAG 3 cut(s) 972, 2490, 2708
BssT1I CCWWGG 4 cut(s) 102, 252, 1173, 2205
Bst2BI CACGAG 3 cut(s) 972, 2490, 2708
Bst2UI CCWGG 3 cut(s) 455, 1382, 2294
Bst4CI ACNGT 9 cut(s) 418, 555, 704, 1547, 2229, 2524, 2759, 2786, 2824
Bst6I CTCTTC 1 cut(s) 1128
BstACI GRCGYC 1 cut(s) 2790
BstAFI CTTAAG 2 cut(s) 220, 2626
BstAPI GCANNNNNTGC 4 cut(s) 303, 610, 895, 1148
BstBI TTCGAA 1 cut(s) 1365
BstF5I GGATG 2 cut(s) 538, 2614
BstFNI CGCG 2 cut(s) 1026, 1528
BstHHI GCGC 3 cut(s) 1026, 1028, 1528
BstMAI GTCTC 6 cut(s) 62, 265, 845, 1130, 1409, 1734
BstMWI GCNNNNNNNGC 7 cut(s) 303, 610, 895, 1034, 1148, 2089, 2303
BstNI CCWGG 3 cut(s) 455, 1382, 2294
BstNSI RCATGY 1 cut(s) 1830
BstPAI GACNNNNGTC 2 cut(s) 74, 1401
BstSCI CCNGG 3 cut(s) 453, 1380, 2292
BstSFI CTRYAG 2 cut(s) 137, 1449
BstSLI GKGCMC 2 cut(s) 1440, 2651
BstUI CGCG 2 cut(s) 1026, 1528
BstV2I GAAGAC 2 cut(s) 2825, 3000
BstX2I RGATCY 4 cut(s) 1183, 1897, 2703, 2851
BstXI CCANNNNNNTGG 1 cut(s) 1681
BstYI RGATCY 4 cut(s) 1183, 1897, 2703, 2851
BsuI GTATCC 1 cut(s) 1681
BsuRI GGCC 5 cut(s) 390, 1343, 2292, 2297, 3000
BtgZI GCGATG 1 cut(s) 2252
BtsCI GGATG 2 cut(s) 538, 2614
BtsI GCAGTG 2 cut(s) 1446, 1672
BtsIMutI CAGTG 7 cut(s) 1446, 1672, 1945, 2187, 2520, 2764, 2791
CciI TCATGA 2 cut(s) 1596, 3028
CfoI GCGC 3 cut(s) 1026, 1028, 1528
Cfr13I GGNCC 2 cut(s) 2185, 2752
Csp6I GTAC 3 cut(s) 689, 1166, 2402
CspCI CAANNNNNGTGG 2 cut(s) 1510, 1545
CviQI GTAC 3 cut(s) 689, 1166, 2402
DraI TTTAAA 1 cut(s) 477
DraIII CACNNNGTG 1 cut(s) 2646
DrdI GACNNNNNNGTC 1 cut(s) 1550
DseDI GACNNNNNNGTC 1 cut(s) 1550
EaeI YGGCCR 3 cut(s) 1341, 2290, 2998
Eam1104I CTCTTC 1 cut(s) 1128
EarI CTCTTC 1 cut(s) 1128
Ecl136II GAGCTC 1 cut(s) 1594
Eco130I CCWWGG 4 cut(s) 102, 252, 1173, 2205
Eco147I AGGCCT 1 cut(s) 390
Eco24I GRGCYC 1 cut(s) 1596
Eco31I GGTCTC 2 cut(s) 265, 1130
Eco32I GATATC 1 cut(s) 539
Eco47I GGWCC 2 cut(s) 2185, 2752
Eco53kI GAGCTC 1 cut(s) 1594
Eco57I CTGAAG 4 cut(s) 405, 787, 2078, 2178
EcoICRI GAGCTC 1 cut(s) 1594
EcoRI GAATTC 1 cut(s) 1504
EcoRII CCWGG 3 cut(s) 453, 1380, 2292
EcoRV GATATC 1 cut(s) 539
EcoT14I CCWWGG 4 cut(s) 102, 252, 1173, 2205
EcoT22I ATGCAT 1 cut(s) 183
EcoT38I GRGCYC 1 cut(s) 1596
ErhI CCWWGG 4 cut(s) 102, 252, 1173, 2205
FalI AAGNNNNNCTT 4 cut(s) 597, 629, 1122, 1154
FaqI GGGAC 1 cut(s) 2777
FauI CCCGC 1 cut(s) 1939
FblI GTMKAC 1 cut(s) 815
FokI GGATG 2 cut(s) 545, 2621
FriOI GRGCYC 1 cut(s) 1596
GlaI GCGC 3 cut(s) 1025, 1027, 1527
GsuI CTGGAG 1 cut(s) 1403
HaeIII GGCC 5 cut(s) 390, 1343, 2292, 2297, 3000
HhaI GCGC 3 cut(s) 1026, 1028, 1528
Hin1I GRCGYC 1 cut(s) 2790
Hin6I GCGC 3 cut(s) 1024, 1026, 1526
HinP1I GCGC 3 cut(s) 1024, 1026, 1526
HindIII AAGCTT 4 cut(s) 92, 326, 2063, 2484
HphI GGTGA 4 cut(s) 1553, 2258, 2410, 2540
Hpy166II GTNNAC 8 cut(s) 816, 1438, 1532, 2185, 2249, 2649, 2755, 2951
Hpy8I GTNNAC 8 cut(s) 816, 1438, 1532, 2185, 2249, 2649, 2755, 2951
HpyCH4III ACNGT 9 cut(s) 418, 555, 704, 1547, 2229, 2524, 2759, 2786, 2824
HpyCH4IV ACGT 3 cut(s) 745, 2106, 2790
HpyF10VI GCNNNNNNNGC 7 cut(s) 303, 610, 895, 1034, 1148, 2089, 2303
HpySE526I ACGT 3 cut(s) 745, 2106, 2790
Hsp92I GRCGYC 1 cut(s) 2790
HspAI GCGC 3 cut(s) 1024, 1026, 1526
LguI GCTCTTC 1 cut(s) 1128
LmnI GCTCC 3 cut(s) 625, 2131, 2278
LweI GCATC 8 cut(s) 168, 238, 400, 2367, 2397, 2554, 2599, 2678
MaeII ACGT 3 cut(s) 745, 2106, 2790
MaeIII GTNAC 8 cut(s) 148, 241, 315, 698, 1541, 2589, 2638, 2786
MbiI CCGCTC 1 cut(s) 2266
MfeI CAATTG 2 cut(s) 1686, 2594
MflI RGATCY 4 cut(s) 1183, 1897, 2703, 2851
MhlI GDGCHC 3 cut(s) 1440, 1596, 2651
MlsI TGGCCA 1 cut(s) 2292
MluNI TGGCCA 1 cut(s) 2292
MlyI GAGTC 5 cut(s) 64, 1391, 1394, 1727, 2929
MmeI TCCRAC 3 cut(s) 468, 1873, 2211
Mox20I TGGCCA 1 cut(s) 2292
Mph1103I ATGCAT 1 cut(s) 183
MroXI GAANNNNTTC 1 cut(s) 1316
MscI TGGCCA 1 cut(s) 2292
MslI CAYNNNNRTG 4 cut(s) 186, 375, 1539, 1803
Msp20I TGGCCA 1 cut(s) 2292
MspA1I CMGCKG 4 cut(s) 110, 383, 1454, 1841
MspCI CTTAAG 2 cut(s) 220, 2626
MspR9I CCNGG 3 cut(s) 455, 1382, 2294
MunI CAATTG 2 cut(s) 1686, 2594
MvaI CCWGG 3 cut(s) 455, 1382, 2294
MvnI CGCG 2 cut(s) 1026, 1528
MwoI GCNNNNNNNGC 7 cut(s) 303, 610, 895, 1034, 1148, 2089, 2303
NlaIV GGNNCC 3 cut(s) 379, 451, 2753
NmuCI GTSAC 5 cut(s) 698, 1541, 2589, 2638, 2786
NsiI ATGCAT 1 cut(s) 183
NspI RCATGY 1 cut(s) 1830
NspV TTCGAA 1 cut(s) 1365
PaeI GCATGC 1 cut(s) 1830
PagI TCATGA 2 cut(s) 1596, 3028
PauI GCGCGC 1 cut(s) 1024
PceI AGGCCT 1 cut(s) 390
PciSI GCTCTTC 1 cut(s) 1128
PdmI GAANNNNTTC 1 cut(s) 1316
PfeI GAWTC 8 cut(s) 193, 458, 845, 1967, 2192, 2828, 2963, 3025
PleI GAGTC 5 cut(s) 64, 1391, 1393, 1726, 2929
PpsI GAGTC 5 cut(s) 64, 1391, 1393, 1726, 2929
PshAI GACNNNNGTC 2 cut(s) 74, 1401
Psp124BI GAGCTC 1 cut(s) 1596
Psp1406I AACGTT 1 cut(s) 745
Psp6I CCWGG 3 cut(s) 453, 1380, 2292
PspGI CCWGG 3 cut(s) 453, 1380, 2292
PspN4I GGNNCC 3 cut(s) 379, 451, 2753
PspPI GGNCC 2 cut(s) 2185, 2752
PstI CTGCAG 2 cut(s) 141, 1453
PsuI RGATCY 4 cut(s) 1183, 1897, 2703, 2851
PteI GCGCGC 1 cut(s) 1024
PvuII CAGCTG 3 cut(s) 110, 1454, 1841
RsaI GTAC 3 cut(s) 690, 1167, 2403
RsaNI GTAC 3 cut(s) 689, 1166, 2402
RseI CAYNNNNRTG 4 cut(s) 186, 375, 1539, 1803
SacI GAGCTC 1 cut(s) 1596
SapI GCTCTTC 1 cut(s) 1128
Sau96I GGNCC 2 cut(s) 2185, 2752
SchI GAGTC 5 cut(s) 64, 1391, 1394, 1727, 2929
ScrFI CCNGG 3 cut(s) 455, 1382, 2294
SduI GDGCHC 3 cut(s) 1440, 1596, 2651
SfaNI GCATC 8 cut(s) 168, 238, 400, 2367, 2397, 2554, 2599, 2678
SfcI CTRYAG 2 cut(s) 137, 1449
SfuI TTCGAA 1 cut(s) 1365
SinI GGWCC 2 cut(s) 2185, 2752
SmiMI CAYNNNNRTG 4 cut(s) 186, 375, 1539, 1803
SmlI CTYRAG 7 cut(s) 11, 122, 220, 862, 1732, 2626, 2939
SmoI CTYRAG 7 cut(s) 11, 122, 220, 862, 1732, 2626, 2939
SpeI ACTAGT 1 cut(s) 1832
SphI GCATGC 1 cut(s) 1830
SseBI AGGCCT 1 cut(s) 390
SsiI CCGC 5 cut(s) 381, 1932, 2266, 2570, 2864
SspI AATATT 1 cut(s) 2737
SstI GAGCTC 1 cut(s) 1596
StuI AGGCCT 1 cut(s) 390
StyD4I CCNGG 3 cut(s) 453, 1380, 2292
StyI CCWWGG 4 cut(s) 102, 252, 1173, 2205
TaaI ACNGT 9 cut(s) 418, 555, 704, 1547, 2229, 2524, 2759, 2786, 2824
TaiI ACGT 3 cut(s) 748, 2109, 2793
TaqI TCGA 4 cut(s) 741, 1365, 1557, 3014
TatI WGTACW 1 cut(s) 1165
TauI GCSGC 3 cut(s) 383, 2269, 2867
TfiI GAWTC 8 cut(s) 193, 458, 845, 1967, 2192, 2828, 2963, 3025
TscAI CASTG 7 cut(s) 1453, 1672, 1945, 2187, 2527, 2764, 2791
TseFI GTSAC 5 cut(s) 698, 1541, 2589, 2638, 2786
Tsp45I GTSAC 5 cut(s) 698, 1541, 2589, 2638, 2786
TspGWI ACGGA 1 cut(s) 1616
TspRI CASTG 7 cut(s) 1453, 1672, 1945, 2187, 2527, 2764, 2791
Vha464I CTTAAG 2 cut(s) 220, 2626
VneI GTGCAC 2 cut(s) 1436, 2647
VpaK11BI GGWCC 2 cut(s) 2185, 2752
XbaI TCTAGA 2 cut(s) 541, 1297
XceI RCATGY 1 cut(s) 1830
XcmI CCANNNNNNNNNTGG 1 cut(s) 2659
XmiI GTMKAC 1 cut(s) 815
XmnI GAANNNNTTC 1 cut(s) 1316
ZraI GACGTC 1 cut(s) 2791
Zsp2I ATGCAT 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.