Prupe.8G072300_v2.0.a1

Auxin responsive protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
10611481 .. 10611777
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G072300.1

Sequence Viewer

Length: 297 bp
ATGAATCCTGCAAGTCTTGTCAAAGAAAAAATCATGTTTTTCATCAAGAAGTTATGCAAATCACACTCTAAGAAGCATGGAGTAGTTCCGAAAGGTTATATACCCGTGTACGTCGGAAAAGGAAAAGAACGAAAGAGATACTGTCTTCCTTTGAAGTATATCTCCCATCCAACCGTCCAAGAACTCATCGAGAAGTCCCAAGCCGATGTGTTTGATCCAAAGATTGAAGGGCCTTTTGTGCTTACATGTAATACTAACACCTTCGATCAGTTGCTGAAGATCTTCAAGGAATACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.35

Weight (kDa)

9.56

Isoelectric Point (pI)

20.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 209
AcuI CTGAAG 1 cut(s) 296
AfaI GTAC 1 cut(s) 110
AflIII ACRYGT 1 cut(s) 245
AgsI TTSAA 3 cut(s) 154, 227, 286
AlwI GGATC 1 cut(s) 209
AlwNI CAGNNNCTG 1 cut(s) 274
AoxI GGCC 1 cut(s) 230
Asp700I GAANNNNTTC 1 cut(s) 281
AspS9I GGNCC 1 cut(s) 230
BbsI GAAGAC 1 cut(s) 137
BccI CCATC 1 cut(s) 174
BfaI CTAG 1 cut(s) 295
BglII AGATCT 1 cut(s) 279
BmgT120I GGNCC 1 cut(s) 230
BpiI GAAGAC 1 cut(s) 137
BseGI GGATG 1 cut(s) 166
BshFI GGCC 1 cut(s) 232
BslFI GGGAC 1 cut(s) 181
BsmFI GGGAC 1 cut(s) 181
BsnI GGCC 1 cut(s) 232
Bsp143I GATC 3 cut(s) 214, 265, 279
BspANI GGCC 1 cut(s) 232
BspPI GGATC 1 cut(s) 209
BssMI GATC 3 cut(s) 214, 265, 279
Bst4CI ACNGT 2 cut(s) 143, 175
BstDEI CTNAG 1 cut(s) 69
BstF5I GGATG 1 cut(s) 166
BstKTI GATC 3 cut(s) 217, 268, 282
BstMBI GATC 3 cut(s) 214, 265, 279
BstMWI GCNNNNNNNGC 1 cut(s) 238
BstNSI RCATGY 1 cut(s) 249
BstV2I GAAGAC 1 cut(s) 137
BstX2I RGATCY 1 cut(s) 279
BstYI RGATCY 1 cut(s) 279
BsuRI GGCC 1 cut(s) 232
BtsCI GGATG 1 cut(s) 166
CaiI CAGNNNCTG 1 cut(s) 274
Cfr13I GGNCC 1 cut(s) 230
Csp6I GTAC 1 cut(s) 109
CviAII CATG 3 cut(s) 34, 77, 246
CviJI RGCY 2 cut(s) 203, 232
CviKI_1 RGCY 2 cut(s) 203, 232
CviQI GTAC 1 cut(s) 109
DdeI CTNAG 1 cut(s) 69
DpnI GATC 3 cut(s) 216, 267, 281
DpnII GATC 3 cut(s) 214, 265, 279
Eco57I CTGAAG 1 cut(s) 296
EcoO109I RGGNCCY 1 cut(s) 230
FaeI CATG 3 cut(s) 37, 80, 249
FaiI YATR 7 cut(s) 35, 55, 78, 99, 101, 159, 247
FaqI GGGAC 1 cut(s) 181
FatI CATG 3 cut(s) 33, 76, 245
FokI GGATG 1 cut(s) 153
FspBI CTAG 1 cut(s) 295
HaeIII GGCC 1 cut(s) 232
Hin1II CATG 3 cut(s) 37, 80, 249
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 109
Hpy188I TCNGA 2 cut(s) 90, 116
Hpy188III TCNNGA 2 cut(s) 46, 190
Hpy8I GTNNAC 1 cut(s) 109
Hpy99I CGWCG 1 cut(s) 116
HpyAV CCTTC 2 cut(s) 221, 271
HpyCH4III ACNGT 2 cut(s) 143, 175
HpyCH4IV ACGT 1 cut(s) 111
HpyCH4V TGCA 2 cut(s) 11, 57
HpyF10VI GCNNNNNNNGC 1 cut(s) 238
HpyF3I CTNAG 1 cut(s) 69
HpySE526I ACGT 1 cut(s) 111
Hsp92II CATG 3 cut(s) 37, 80, 249
Kzo9I GATC 3 cut(s) 214, 265, 279
LpnPI CCDG 1 cut(s) 21
MaeI CTAG 1 cut(s) 295
MaeII ACGT 1 cut(s) 111
MalI GATC 3 cut(s) 216, 267, 281
MboI GATC 3 cut(s) 214, 265, 279
MboII GAAGA 3 cut(s) 137, 274, 289
MflI RGATCY 1 cut(s) 279
MmeI TCCRAC 2 cut(s) 94, 194
MroXI GAANNNNTTC 1 cut(s) 281
MwoI GCNNNNNNNGC 1 cut(s) 238
NdeII GATC 3 cut(s) 214, 265, 279
NlaIII CATG 3 cut(s) 37, 80, 249
NspI RCATGY 1 cut(s) 249
PciI ACATGT 1 cut(s) 245
PdmI GAANNNNTTC 1 cut(s) 281
PfeI GAWTC 1 cut(s) 4
PscI ACATGT 1 cut(s) 245
PspPI GGNCC 1 cut(s) 230
PstNI CAGNNNCTG 1 cut(s) 274
PsuI RGATCY 1 cut(s) 279
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
Sau3AI GATC 3 cut(s) 214, 265, 279
Sau96I GGNCC 1 cut(s) 230
SetI ASST 3 cut(s) 97, 114, 263
SspMI CTAG 1 cut(s) 295
TaaI ACNGT 2 cut(s) 143, 175
TaiI ACGT 1 cut(s) 114
TaqI TCGA 2 cut(s) 189, 264
TfiI GAWTC 1 cut(s) 4
TspDTI ATGAA 2 cut(s) 17, 31
XceI RCATGY 1 cut(s) 249
XmnI GAANNNNTTC 1 cut(s) 281
XspI CTAG 1 cut(s) 295
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.