Rh3BG256200

Protein trichome birefringence-like 43

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
24838205 .. 24838561
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG256200.1

Sequence Viewer

Length: 357 bp
ATGAGGTTCATGAATCCTGCATGTCTTTTCAACAAGCTAGGAAGAAGCCACACCAAGAAGTCATACGAACGGTTGGTACATGCAGATGACCAGGTCCAGAGGTCCAAGAAGAAGCACGGTTCAGCTCCAAAAGGTTCTATAGATTTGTTCGTGGGGAAAGAGGAGAAGAAATACCCAGTTCCCCTCAAGTACTTTACACACCCAAAGCTCCAAGAACTTCTCAAAGAGTACCAAGAACCCGTGTTTGATCCAAGATTTGATGAGCCGATTGTGCTTGAATGTTCTACGGAGACCTTTGAGCAGTTGCTCCATTATATCGTCAAGGCTCAGAAGTCAGCAGTATTCATTAGAATTTAA

Protein Analysis

118

Amino Acids

13.87

Weight (kDa)

9.34

Isoelectric Point (pI)

47.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 24 - 105 2.9e-12 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 242
AcsI RAATTY 1 cut(s) 351
AfaI GTAC 3 cut(s) 78, 191, 230
AgsI TTSAA 2 cut(s) 31, 278
AjnI CCWGG 1 cut(s) 90
AluBI AGCT 3 cut(s) 37, 125, 208
AluI AGCT 3 cut(s) 37, 125, 208
Alw26I GTCTC 1 cut(s) 284
AlwI GGATC 1 cut(s) 242
ApoI RAATTY 1 cut(s) 351
AspS9I GGNCC 2 cut(s) 94, 102
AvaII GGWCC 2 cut(s) 94, 102
BciT130I CCWGG 1 cut(s) 92
BcoDI GTCTC 1 cut(s) 284
BfaI CTAG 1 cut(s) 38
BfmI CTRYAG 1 cut(s) 138
BmcAI AGTACT 1 cut(s) 191
Bme1390I CCNGG 1 cut(s) 92
Bme18I GGWCC 2 cut(s) 94, 102
BmgT120I GGNCC 2 cut(s) 94, 102
BmrFI CCNGG 1 cut(s) 92
BmrI ACTGGG 1 cut(s) 170
BmuI ACTGGG 1 cut(s) 170
BpuEI CTTGAG 1 cut(s) 170
BsaI GGTCTC 1 cut(s) 284
Bse1I ACTGG 1 cut(s) 176
BseBI CCWGG 1 cut(s) 92
BseMII CTCAG 1 cut(s) 341
BseNI ACTGG 1 cut(s) 176
BseRI GAGGAG 1 cut(s) 176
BsmAI GTCTC 1 cut(s) 284
Bso31I GGTCTC 1 cut(s) 284
Bsp143I GATC 1 cut(s) 247
BspCNI CTCAG 1 cut(s) 340
BspHI TCATGA 1 cut(s) 9
BspPI GGATC 1 cut(s) 242
BspTNI GGTCTC 1 cut(s) 284
BsrI ACTGG 1 cut(s) 176
BssMI GATC 1 cut(s) 247
Bst2UI CCWGG 1 cut(s) 92
Bst4CI ACNGT 2 cut(s) 72, 119
BstDEI CTNAG 1 cut(s) 327
BstKTI GATC 1 cut(s) 250
BstMAI GTCTC 1 cut(s) 284
BstMBI GATC 1 cut(s) 247
BstMWI GCNNNNNNNGC 1 cut(s) 271
BstNI CCWGG 1 cut(s) 92
BstNSI RCATGY 2 cut(s) 24, 83
BstSCI CCNGG 1 cut(s) 90
BstSFI CTRYAG 1 cut(s) 138
CciI TCATGA 1 cut(s) 9
Cfr13I GGNCC 2 cut(s) 94, 102
CsiI ACCWGGT 1 cut(s) 90
Csp6I GTAC 3 cut(s) 77, 190, 229
CviAII CATG 3 cut(s) 10, 21, 80
CviJI RGCY 6 cut(s) 37, 48, 125, 208, 265, 326
CviKI_1 RGCY 6 cut(s) 37, 48, 125, 208, 265, 326
CviQI GTAC 3 cut(s) 77, 190, 229
DdeI CTNAG 1 cut(s) 327
DpnI GATC 1 cut(s) 249
DpnII GATC 1 cut(s) 247
Eco31I GGTCTC 1 cut(s) 284
Eco47I GGWCC 2 cut(s) 94, 102
EcoRII CCWGG 1 cut(s) 90
FaeI CATG 3 cut(s) 13, 24, 83
FaiI YATR 6 cut(s) 11, 22, 64, 81, 140, 315
FatI CATG 3 cut(s) 9, 20, 79
FspBI CTAG 1 cut(s) 38
Hin1II CATG 3 cut(s) 13, 24, 83
HinfI GANTC 1 cut(s) 13
Hpy188I TCNGA 1 cut(s) 330
Hpy188III TCNNGA 2 cut(s) 10, 97
HpyCH4III ACNGT 2 cut(s) 72, 119
HpyCH4V TGCA 2 cut(s) 20, 83
HpyF10VI GCNNNNNNNGC 1 cut(s) 271
HpyF3I CTNAG 1 cut(s) 327
Hsp92II CATG 3 cut(s) 13, 24, 83
Kzo9I GATC 1 cut(s) 247
LmnI GCTCC 3 cut(s) 130, 213, 312
LpnPI CCDG 5 cut(s) 30, 77, 104, 110, 189
MabI ACCWGGT 1 cut(s) 90
MaeI CTAG 1 cut(s) 38
MalI GATC 1 cut(s) 249
MboI GATC 1 cut(s) 247
MboII GAAGA 3 cut(s) 54, 121, 178
MluCI AATT 1 cut(s) 351
MnlI CCTC 3 cut(s) 93, 154, 194
MseI TTAA 1 cut(s) 355
MslI CAYNNNNRTG 1 cut(s) 84
MspR9I CCNGG 1 cut(s) 92
MvaI CCWGG 1 cut(s) 92
MwoI GCNNNNNNNGC 1 cut(s) 271
NdeII GATC 1 cut(s) 247
NlaIII CATG 3 cut(s) 13, 24, 83
NspI RCATGY 2 cut(s) 24, 83
PagI TCATGA 1 cut(s) 9
PfeI GAWTC 1 cut(s) 13
PflFI GACNNNGTC 1 cut(s) 92
Psp6I CCWGG 1 cut(s) 90
PspGI CCWGG 1 cut(s) 90
PspPI GGNCC 2 cut(s) 94, 102
PsrI GAACNNNNNNTAC 2 cut(s) 60, 92
PsyI GACNNNGTC 1 cut(s) 92
RsaI GTAC 3 cut(s) 78, 191, 230
RsaNI GTAC 3 cut(s) 77, 190, 229
RseI CAYNNNNRTG 1 cut(s) 84
SaqAI TTAA 1 cut(s) 355
Sau3AI GATC 1 cut(s) 247
Sau96I GGNCC 2 cut(s) 94, 102
ScaI AGTACT 1 cut(s) 191
ScrFI CCNGG 1 cut(s) 92
SetI ASST 8 cut(s) 8, 39, 96, 104, 127, 136, 210, 296
SexAI ACCWGGT 1 cut(s) 90
SfcI CTRYAG 1 cut(s) 138
SinI GGWCC 2 cut(s) 94, 102
SmiMI CAYNNNNRTG 1 cut(s) 84
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
Sse9I AATT 1 cut(s) 351
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 1 cut(s) 90
TaaI ACNGT 2 cut(s) 72, 119
TasI AATT 1 cut(s) 351
TatI WGTACW 1 cut(s) 189
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 1 cut(s) 355
Tru9I TTAA 1 cut(s) 355
TspDTI ATGAA 2 cut(s) 26, 334
TspGWI ACGGA 1 cut(s) 302
Tth111I GACNNNGTC 1 cut(s) 92
VpaK11BI GGWCC 2 cut(s) 94, 102
XapI RAATTY 1 cut(s) 351
XceI RCATGY 2 cut(s) 24, 83
XspI CTAG 1 cut(s) 38
ZrmI AGTACT 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.