Rh3DG248500

Protein trichome birefringence-like 43

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
24417019 .. 24417351
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG248500.1

Sequence Viewer

Length: 333 bp
ATGAGGTTCATGAATCCTACATCTCTTATCAACAAGCTAGGAAGAAGCCACTCCAAGAAGTCATACGCACGGTTAGTACATGCAGATGACCAGGTCGAGAGGTCCAAGAAGAAACATGGTTCAGCTCCGAAAGGTTCTATAGATTTGTTTGTGGGCAAAGAGGAGAAGAAATACCCAGTTCCCCTCAAGTACTTTACACACCCAAAGCTCCAAGAACTCCTCAAGGAGTACCAAGAACCCGTGTTCGATCCAAGATTTGATGAGCCGATTGTGCTGGAATGTTCTACGGAGACCTTTGAGCAGTTGCTCCACTATATCGTCAAGACTCAATAA

Protein Analysis

110

Amino Acids

12.89

Weight (kDa)

9.16

Isoelectric Point (pI)

45.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 23 - 105 1.9e-12 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 242
AfaI GTAC 3 cut(s) 78, 191, 230
AjnI CCWGG 1 cut(s) 90
AluBI AGCT 3 cut(s) 37, 125, 208
AluI AGCT 3 cut(s) 37, 125, 208
Alw26I GTCTC 1 cut(s) 284
AlwI GGATC 1 cut(s) 242
AspS9I GGNCC 1 cut(s) 102
AvaII GGWCC 1 cut(s) 102
BciT130I CCWGG 1 cut(s) 92
BcoDI GTCTC 1 cut(s) 284
BfaI CTAG 1 cut(s) 38
BfmI CTRYAG 1 cut(s) 138
BmcAI AGTACT 1 cut(s) 191
Bme1390I CCNGG 1 cut(s) 92
Bme18I GGWCC 1 cut(s) 102
BmgT120I GGNCC 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 92
BmrI ACTGGG 1 cut(s) 170
BmuI ACTGGG 1 cut(s) 170
BpuEI CTTGAG 2 cut(s) 170, 206
BsaI GGTCTC 1 cut(s) 284
Bse1I ACTGG 1 cut(s) 176
BseBI CCWGG 1 cut(s) 92
BseNI ACTGG 1 cut(s) 176
BseRI GAGGAG 2 cut(s) 176, 209
BsmAI GTCTC 1 cut(s) 284
Bso31I GGTCTC 1 cut(s) 284
Bsp143I GATC 1 cut(s) 247
BspHI TCATGA 1 cut(s) 9
BspPI GGATC 1 cut(s) 242
BspTNI GGTCTC 1 cut(s) 284
BsrI ACTGG 1 cut(s) 176
BssMI GATC 1 cut(s) 247
Bst2UI CCWGG 1 cut(s) 92
Bst4CI ACNGT 1 cut(s) 72
BstKTI GATC 1 cut(s) 250
BstMAI GTCTC 1 cut(s) 284
BstMBI GATC 1 cut(s) 247
BstMWI GCNNNNNNNGC 1 cut(s) 271
BstNI CCWGG 1 cut(s) 92
BstNSI RCATGY 1 cut(s) 83
BstSCI CCNGG 1 cut(s) 90
BstSFI CTRYAG 1 cut(s) 138
CciI TCATGA 1 cut(s) 9
Cfr13I GGNCC 1 cut(s) 102
CsiI ACCWGGT 1 cut(s) 90
Csp6I GTAC 3 cut(s) 77, 190, 229
CviAII CATG 3 cut(s) 10, 80, 116
CviJI RGCY 5 cut(s) 37, 48, 125, 208, 265
CviKI_1 RGCY 5 cut(s) 37, 48, 125, 208, 265
CviQI GTAC 3 cut(s) 77, 190, 229
DpnI GATC 1 cut(s) 249
DpnII GATC 1 cut(s) 247
Eco31I GGTCTC 1 cut(s) 284
Eco47I GGWCC 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 90
FaeI CATG 3 cut(s) 13, 83, 119
FaiI YATR 6 cut(s) 11, 64, 81, 117, 140, 315
FatI CATG 3 cut(s) 9, 79, 115
FspBI CTAG 1 cut(s) 38
Hin1II CATG 3 cut(s) 13, 83, 119
HinfI GANTC 2 cut(s) 13, 325
Hpy188I TCNGA 1 cut(s) 129
Hpy188III TCNNGA 3 cut(s) 10, 97, 322
HpyCH4III ACNGT 1 cut(s) 72
HpyCH4V TGCA 1 cut(s) 83
HpyF10VI GCNNNNNNNGC 1 cut(s) 271
Hsp92II CATG 3 cut(s) 13, 83, 119
Kzo9I GATC 1 cut(s) 247
LmnI GCTCC 3 cut(s) 130, 213, 312
LpnPI CCDG 4 cut(s) 77, 104, 189, 260
MabI ACCWGGT 1 cut(s) 90
MaeI CTAG 1 cut(s) 38
MalI GATC 1 cut(s) 249
MboI GATC 1 cut(s) 247
MboII GAAGA 3 cut(s) 54, 121, 178
MlyI GAGTC 1 cut(s) 319
MnlI CCTC 4 cut(s) 93, 154, 194, 230
MslI CAYNNNNRTG 1 cut(s) 84
MspR9I CCNGG 1 cut(s) 92
MvaI CCWGG 1 cut(s) 92
MwoI GCNNNNNNNGC 1 cut(s) 271
NdeII GATC 1 cut(s) 247
NlaIII CATG 3 cut(s) 13, 83, 119
NspI RCATGY 1 cut(s) 83
PagI TCATGA 1 cut(s) 9
PfeI GAWTC 1 cut(s) 13
PflFI GACNNNGTC 1 cut(s) 92
PleI GAGTC 1 cut(s) 319
PpsI GAGTC 1 cut(s) 319
Psp6I CCWGG 1 cut(s) 90
PspGI CCWGG 1 cut(s) 90
PspPI GGNCC 1 cut(s) 102
PsyI GACNNNGTC 1 cut(s) 92
RsaI GTAC 3 cut(s) 78, 191, 230
RsaNI GTAC 3 cut(s) 77, 190, 229
RseI CAYNNNNRTG 1 cut(s) 84
Sau3AI GATC 1 cut(s) 247
Sau96I GGNCC 1 cut(s) 102
ScaI AGTACT 1 cut(s) 191
SchI GAGTC 1 cut(s) 319
ScrFI CCNGG 1 cut(s) 92
SetI ASST 8 cut(s) 8, 39, 96, 104, 127, 136, 210, 296
SexAI ACCWGGT 1 cut(s) 90
SfcI CTRYAG 1 cut(s) 138
SinI GGWCC 1 cut(s) 102
SmiMI CAYNNNNRTG 1 cut(s) 84
SmlI CTYRAG 2 cut(s) 185, 221
SmoI CTYRAG 2 cut(s) 185, 221
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 1 cut(s) 90
TaaI ACNGT 1 cut(s) 72
TaqI TCGA 2 cut(s) 96, 246
TatI WGTACW 2 cut(s) 76, 189
TfiI GAWTC 1 cut(s) 13
TspDTI ATGAA 1 cut(s) 26
TspGWI ACGGA 1 cut(s) 302
Tth111I GACNNNGTC 1 cut(s) 92
VpaK11BI GGWCC 1 cut(s) 102
XceI RCATGY 1 cut(s) 83
XspI CTAG 1 cut(s) 38
ZrmI AGTACT 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.