Prupe.8G072400_v2.0.a1

Auxin responsive protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Forward (+)
10619587 .. 10619877
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G072400.1

Sequence Viewer

Length: 291 bp
ATGAATCCTGCAAGTCTTGTCCAAGAAAAAATCAGGTTGTTCATAGAGAAGTTAGGCAAATCACTCTCGAAGAAGCATGGAGTAGTTCCAAAAGGTTATATAGATGTGTACCTCGGAAAAGAACGAAAGAGCTACCGAGTTCCTTTGAAGTATCTCTTGTATCCAACTTTCGAAAAACTCATCAAGAAGTCCCAAACCGATGTGCTCGATCCAAATATTGAAGGGCCTTTTATGCTTACATGTAATACTAACACCTTCGATAAGTTGCTGAAGATATTCAAGGAATACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

11.2

Weight (kDa)

9.62

Isoelectric Point (pI)

20.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 203
AcuI CTGAAG 1 cut(s) 290
AfaI GTAC 1 cut(s) 110
AflIII ACRYGT 1 cut(s) 239
AgsI TTSAA 3 cut(s) 148, 221, 280
AluBI AGCT 1 cut(s) 132
AluI AGCT 1 cut(s) 132
Alw21I GWGCWC 1 cut(s) 207
AlwI GGATC 1 cut(s) 203
AoxI GGCC 1 cut(s) 224
Asp700I GAANNNNTTC 1 cut(s) 275
AspS9I GGNCC 1 cut(s) 224
AsuII TTCGAA 1 cut(s) 171
Bbv12I GWGCWC 1 cut(s) 207
BciVI GTATCC 1 cut(s) 171
BfaI CTAG 1 cut(s) 289
BfuI GTATCC 1 cut(s) 171
BmgT120I GGNCC 1 cut(s) 224
Bpu14I TTCGAA 1 cut(s) 171
BsaJI CCNNGG 1 cut(s) 112
BseDI CCNNGG 1 cut(s) 112
BshFI GGCC 1 cut(s) 226
BsiHKAI GWGCWC 1 cut(s) 207
BslFI GGGAC 1 cut(s) 175
BsmFI GGGAC 1 cut(s) 175
BsnI GGCC 1 cut(s) 226
Bsp119I TTCGAA 1 cut(s) 171
Bsp1286I GDGCHC 1 cut(s) 207
Bsp143I GATC 1 cut(s) 208
BspANI GGCC 1 cut(s) 226
BspPI GGATC 1 cut(s) 203
BspT104I TTCGAA 1 cut(s) 171
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 1 cut(s) 208
BstBI TTCGAA 1 cut(s) 171
BstKTI GATC 1 cut(s) 211
BstMBI GATC 1 cut(s) 208
BstMWI GCNNNNNNNGC 1 cut(s) 232
BstNSI RCATGY 1 cut(s) 243
BsuI GTATCC 1 cut(s) 171
BsuRI GGCC 1 cut(s) 226
Cfr13I GGNCC 1 cut(s) 224
Csp6I GTAC 1 cut(s) 109
CviAII CATG 2 cut(s) 77, 240
CviJI RGCY 2 cut(s) 132, 226
CviKI_1 RGCY 2 cut(s) 132, 226
CviQI GTAC 1 cut(s) 109
DpnI GATC 1 cut(s) 210
DpnII GATC 1 cut(s) 208
Eco57I CTGAAG 1 cut(s) 290
EcoO109I RGGNCCY 1 cut(s) 224
FaeI CATG 2 cut(s) 80, 243
FaiI YATR 6 cut(s) 44, 78, 99, 101, 233, 241
FalI AAGNNNNNCTT 2 cut(s) 140, 172
FaqI GGGAC 1 cut(s) 175
FatI CATG 2 cut(s) 76, 239
FspBI CTAG 1 cut(s) 289
HaeIII GGCC 1 cut(s) 226
Hin1II CATG 2 cut(s) 80, 243
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 116
Hpy188III TCNNGA 2 cut(s) 67, 184
Hpy8I GTNNAC 1 cut(s) 109
HpyAV CCTTC 2 cut(s) 215, 265
HpyCH4V TGCA 1 cut(s) 11
HpyF10VI GCNNNNNNNGC 1 cut(s) 232
Hsp92II CATG 2 cut(s) 80, 243
Kzo9I GATC 1 cut(s) 208
LpnPI CCDG 2 cut(s) 19, 21
MaeI CTAG 1 cut(s) 289
MalI GATC 1 cut(s) 210
MboI GATC 1 cut(s) 208
MboII GAAGA 2 cut(s) 82, 283
MhlI GDGCHC 1 cut(s) 207
MmeI TCCRAC 1 cut(s) 188
MnlI CCTC 1 cut(s) 122
MroXI GAANNNNTTC 1 cut(s) 275
MwoI GCNNNNNNNGC 1 cut(s) 232
NdeII GATC 1 cut(s) 208
NlaIII CATG 2 cut(s) 80, 243
NspI RCATGY 1 cut(s) 243
NspV TTCGAA 1 cut(s) 171
PciI ACATGT 1 cut(s) 239
PdmI GAANNNNTTC 1 cut(s) 275
PfeI GAWTC 1 cut(s) 4
PscI ACATGT 1 cut(s) 239
PspPI GGNCC 1 cut(s) 224
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
Sau3AI GATC 1 cut(s) 208
Sau96I GGNCC 1 cut(s) 224
SduI GDGCHC 1 cut(s) 207
SetI ASST 5 cut(s) 38, 97, 114, 134, 257
SfuI TTCGAA 1 cut(s) 171
SspI AATATT 1 cut(s) 217
SspMI CTAG 1 cut(s) 289
TaqI TCGA 4 cut(s) 68, 171, 207, 258
TfiI GAWTC 1 cut(s) 4
TspDTI ATGAA 2 cut(s) 17, 31
XceI RCATGY 1 cut(s) 243
XmnI GAANNNNTTC 1 cut(s) 275
XspI CTAG 1 cut(s) 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.