Rmu_sc0015470.1_g000008

Protein trichome birefringence-like 43

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015470.1
Physical Location & Seq
Reverse (-)
27464 .. 27796
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015470.1_g000008.1.cds

Sequence Viewer

Length: 333 bp
atgaagttcatgaatcctgcatgtcttatcaataagctaggaagaagccactccaagaagtcatacgaacggttggtgcatcaagatgaccaggtcgagaggtccaagaagaagcacggttcagctccaaaaggttctatagatttgttcgtggggaaagaggagaagaaatacccagttcccctcaagtactttacacacccaaagctccaagaactcctcaaagagtaccaagaacccgtgtttgatccaagatttgatgagccgattgtgcttgaatgttctacggagatctttgagcagttgctccgttatatcgtcaagactcgataa

Protein Analysis

110

Amino Acids

13.02

Weight (kDa)

9.21

Isoelectric Point (pI)

52.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 242
AfaI GTAC 2 cut(s) 191, 230
AgsI TTSAA 1 cut(s) 278
AjnI CCWGG 1 cut(s) 90
AluBI AGCT 3 cut(s) 37, 125, 208
AluI AGCT 3 cut(s) 37, 125, 208
AlwI GGATC 1 cut(s) 242
AspS9I GGNCC 1 cut(s) 102
AvaII GGWCC 1 cut(s) 102
BciT130I CCWGG 1 cut(s) 92
BfaI CTAG 1 cut(s) 38
BfmI CTRYAG 1 cut(s) 138
BglII AGATCT 1 cut(s) 291
BmcAI AGTACT 1 cut(s) 191
Bme1390I CCNGG 1 cut(s) 92
Bme18I GGWCC 1 cut(s) 102
BmgT120I GGNCC 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 92
BmrI ACTGGG 1 cut(s) 170
BmsI GCATC 1 cut(s) 88
BmuI ACTGGG 1 cut(s) 170
BpuEI CTTGAG 1 cut(s) 170
Bse1I ACTGG 1 cut(s) 176
BseBI CCWGG 1 cut(s) 92
BseNI ACTGG 1 cut(s) 176
BseRI GAGGAG 2 cut(s) 176, 209
Bsp143I GATC 2 cut(s) 247, 291
BspHI TCATGA 1 cut(s) 9
BspPI GGATC 1 cut(s) 242
BsrI ACTGG 1 cut(s) 176
BssMI GATC 2 cut(s) 247, 291
Bst2UI CCWGG 1 cut(s) 92
Bst4CI ACNGT 2 cut(s) 72, 119
BstKTI GATC 2 cut(s) 250, 294
BstMBI GATC 2 cut(s) 247, 291
BstMWI GCNNNNNNNGC 1 cut(s) 271
BstNI CCWGG 1 cut(s) 92
BstNSI RCATGY 1 cut(s) 24
BstSCI CCNGG 1 cut(s) 90
BstSFI CTRYAG 1 cut(s) 138
BstX2I RGATCY 1 cut(s) 291
BstYI RGATCY 1 cut(s) 291
CciI TCATGA 1 cut(s) 9
Cfr13I GGNCC 1 cut(s) 102
CsiI ACCWGGT 1 cut(s) 90
Csp6I GTAC 2 cut(s) 190, 229
CviAII CATG 2 cut(s) 10, 21
CviJI RGCY 5 cut(s) 37, 48, 125, 208, 265
CviKI_1 RGCY 5 cut(s) 37, 48, 125, 208, 265
CviQI GTAC 2 cut(s) 190, 229
DpnI GATC 2 cut(s) 249, 293
DpnII GATC 2 cut(s) 247, 291
Eco47I GGWCC 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 90
FaeI CATG 2 cut(s) 13, 24
FaiI YATR 5 cut(s) 11, 22, 64, 140, 315
FatI CATG 2 cut(s) 9, 20
FspBI CTAG 1 cut(s) 38
Hin1II CATG 2 cut(s) 13, 24
HinfI GANTC 2 cut(s) 13, 325
Hpy188III TCNNGA 4 cut(s) 10, 83, 97, 322
HpyCH4III ACNGT 2 cut(s) 72, 119
HpyCH4V TGCA 2 cut(s) 20, 79
HpyF10VI GCNNNNNNNGC 1 cut(s) 271
Hsp92II CATG 2 cut(s) 13, 24
Kzo9I GATC 2 cut(s) 247, 291
LmnI GCTCC 3 cut(s) 130, 213, 312
LpnPI CCDG 4 cut(s) 30, 77, 104, 189
LweI GCATC 1 cut(s) 88
MabI ACCWGGT 1 cut(s) 90
MaeI CTAG 1 cut(s) 38
MalI GATC 2 cut(s) 249, 293
MboI GATC 2 cut(s) 247, 291
MboII GAAGA 3 cut(s) 54, 121, 178
MflI RGATCY 1 cut(s) 291
MlyI GAGTC 1 cut(s) 319
MnlI CCTC 4 cut(s) 93, 154, 194, 230
MslI CAYNNNNRTG 1 cut(s) 84
MspR9I CCNGG 1 cut(s) 92
MvaI CCWGG 1 cut(s) 92
MwoI GCNNNNNNNGC 1 cut(s) 271
NdeII GATC 2 cut(s) 247, 291
NlaIII CATG 2 cut(s) 13, 24
NspI RCATGY 1 cut(s) 24
PagI TCATGA 1 cut(s) 9
PfeI GAWTC 1 cut(s) 13
PflFI GACNNNGTC 1 cut(s) 92
PleI GAGTC 1 cut(s) 319
PpsI GAGTC 1 cut(s) 319
Psp6I CCWGG 1 cut(s) 90
PspGI CCWGG 1 cut(s) 90
PspPI GGNCC 1 cut(s) 102
PsuI RGATCY 1 cut(s) 291
PsyI GACNNNGTC 1 cut(s) 92
RsaI GTAC 2 cut(s) 191, 230
RsaNI GTAC 2 cut(s) 190, 229
RseI CAYNNNNRTG 1 cut(s) 84
Sau3AI GATC 2 cut(s) 247, 291
Sau96I GGNCC 1 cut(s) 102
ScaI AGTACT 1 cut(s) 191
SchI GAGTC 1 cut(s) 319
ScrFI CCNGG 1 cut(s) 92
SetI ASST 6 cut(s) 39, 96, 104, 127, 136, 210
SexAI ACCWGGT 1 cut(s) 90
SfaNI GCATC 1 cut(s) 88
SfcI CTRYAG 1 cut(s) 138
SinI GGWCC 1 cut(s) 102
SmiMI CAYNNNNRTG 1 cut(s) 84
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
SspMI CTAG 1 cut(s) 38
StyD4I CCNGG 1 cut(s) 90
TaaI ACNGT 2 cut(s) 72, 119
TaqI TCGA 2 cut(s) 96, 328
TatI WGTACW 1 cut(s) 189
TfiI GAWTC 1 cut(s) 13
TspDTI ATGAA 2 cut(s) 17, 26
TspGWI ACGGA 2 cut(s) 299, 302
Tth111I GACNNNGTC 1 cut(s) 92
VpaK11BI GGWCC 1 cut(s) 102
XceI RCATGY 1 cut(s) 24
XspI CTAG 1 cut(s) 38
ZrmI AGTACT 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.