pycom05g08060

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Forward (+)
10818526 .. 10818720
195 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g08060.1

Sequence Viewer

Length: 195 bp
ATGACCGTAACGAGTCCTGAACGCCGTCTTAGGAACATCATCCCTACTAATCTTCAGCTGATAGTACCCAGACCTCAAGTCTATCTTAGAAAATACACTAGCAACTCTCAGCTGATCAAACAAATCGTCGATACGAGGCAATGGATAACGGTTTTTAATCGTCACCCGATTCAATTGTCTGTAGTCGATACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.59

Weight (kDa)

11.31

Isoelectric Point (pI)

46.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 38
AfaI GTAC 1 cut(s) 66
AgsI TTSAA 1 cut(s) 173
AhdI GACNNNNNGTC 1 cut(s) 77
AluBI AGCT 2 cut(s) 58, 112
AluI AGCT 2 cut(s) 58, 112
ArsI GACNNNNNNTTYG 2 cut(s) 111, 143
AsuHPI GGTGA 1 cut(s) 155
BceAI ACGGC 1 cut(s) 9
BclI TGATCA 1 cut(s) 114
BfaI CTAG 1 cut(s) 99
BfmI CTRYAG 1 cut(s) 180
BmeRI GACNNNNNGTC 1 cut(s) 77
BpuEI CTTGAG 1 cut(s) 60
Bse3DI GCAATG 1 cut(s) 146
BseGI GGATG 1 cut(s) 39
BseMI GCAATG 1 cut(s) 146
BseMII CTCAG 1 cut(s) 122
Bsp143I GATC 1 cut(s) 114
BspCNI CTCAG 1 cut(s) 121
BsrDI GCAATG 1 cut(s) 146
BssMI GATC 1 cut(s) 114
Bst4CI ACNGT 2 cut(s) 7, 151
BstDEI CTNAG 3 cut(s) 29, 86, 108
BstF5I GGATG 1 cut(s) 39
BstKTI GATC 1 cut(s) 117
BstMBI GATC 1 cut(s) 114
BstSFI CTRYAG 1 cut(s) 180
BtsCI GGATG 1 cut(s) 39
Csp6I GTAC 1 cut(s) 65
CviJI RGCY 2 cut(s) 58, 112
CviKI_1 RGCY 2 cut(s) 58, 112
CviQI GTAC 1 cut(s) 65
DdeI CTNAG 3 cut(s) 29, 86, 108
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
DriI GACNNNNNGTC 1 cut(s) 77
Eam1105I GACNNNNNGTC 1 cut(s) 77
Eco57I CTGAAG 1 cut(s) 38
FaiI YATR 1 cut(s) 193
FalI AAGNNNNNCTT 2 cut(s) 69, 101
FbaI TGATCA 1 cut(s) 114
FokI GGATG 1 cut(s) 26
FspBI CTAG 1 cut(s) 99
HinfI GANTC 2 cut(s) 13, 169
HphI GGTGA 1 cut(s) 155
Hpy188III TCNNGA 1 cut(s) 17
Hpy99I CGWCG 1 cut(s) 131
HpyCH4III ACNGT 2 cut(s) 7, 151
HpyF3I CTNAG 3 cut(s) 29, 86, 108
Ksp22I TGATCA 1 cut(s) 114
Kzo9I GATC 1 cut(s) 114
LpnPI CCDG 2 cut(s) 30, 82
MaeI CTAG 1 cut(s) 99
MaeIII GTNAC 2 cut(s) 7, 161
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
MboII GAAGA 1 cut(s) 44
MfeI CAATTG 1 cut(s) 173
MluCI AATT 1 cut(s) 173
MlyI GAGTC 1 cut(s) 22
MnlI CCTC 2 cut(s) 84, 129
MseI TTAA 1 cut(s) 156
MspA1I CMGCKG 2 cut(s) 58, 112
MunI CAATTG 1 cut(s) 173
NdeII GATC 1 cut(s) 114
NmuCI GTSAC 1 cut(s) 161
PfeI GAWTC 1 cut(s) 169
PleI GAGTC 1 cut(s) 21
PpsI GAGTC 1 cut(s) 21
PvuII CAGCTG 2 cut(s) 58, 112
RsaI GTAC 1 cut(s) 66
RsaNI GTAC 1 cut(s) 65
SaqAI TTAA 1 cut(s) 156
Sau3AI GATC 1 cut(s) 114
SchI GAGTC 1 cut(s) 22
SetI ASST 3 cut(s) 60, 76, 114
SfcI CTRYAG 1 cut(s) 180
SgeI CNNG 7 cut(s) 24, 29, 81, 89, 111, 147, 178
SmlI CTYRAG 1 cut(s) 75
SmoI CTYRAG 1 cut(s) 75
Sse9I AATT 1 cut(s) 173
SspMI CTAG 1 cut(s) 99
TaaI ACNGT 2 cut(s) 7, 151
TaqI TCGA 2 cut(s) 129, 186
TasI AATT 1 cut(s) 173
TfiI GAWTC 1 cut(s) 169
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TseFI GTSAC 1 cut(s) 161
Tsp45I GTSAC 1 cut(s) 161
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.