Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

SuperScaffold_420

Orthogroup ID

OG0002049

Physical Location & Seq

Genomic Coordinates Reverse (-)

309516 .. 309782

Gene Structure 267 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom420g00260.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 267 bp

ATGTGTACGCGGAAGCTTGTACACAAAATCCATAGTGATATTTTCCCATTTCCACTCTGGAACGGGAAGCTGCTGCAACAACCCAAACGGCTTCTTCCTTTCCGCCTTAACTTGCTGACAAACAGGACACCTGCTCACATACTCAGTTATCTCCCTCTTCATACCTGGCCAAAAATAAAATGGTCGAATGGTATGATACATTTTAGTAGCTCCTGGATGTATGGCGTAAGCCGAGATATGTGCTTCATCGAGAATTTCTTTCTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

89

Amino Acids

10.56

Weight (kDa)

10.23

Isoelectric Point (pI)

56.12

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002049)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g00950 pycom01g02230 pycom01g02530 pycom01g03240 pycom01g03780 pycom01g03960 pycom01g10590 pycom02g05860 pycom02g18140 pycom02g18750 pycom02g25820 pycom03g06900 pycom03g14140 pycom04g13490 pycom05g06800 pycom05g08060 pycom05g11020 pycom06g01480 pycom07g11130 pycom08g10990 pycom08g12630 pycom08g15990 pycom09g16180 pycom10g06310 pycom11g05150 pycom11g21930 pycom12g00360 pycom12g03890 pycom12g08360 pycom13g22190 pycom13g23920 pycom13g25930 pycom13g26530 pycom13g27310 pycom13g27750 pycom13g28850 pycom15g23410 pycom15g30270 pycom15g35580 pycom16g01960 pycom17g21240 pycom420g00260 pycom808g00230
rosa_chinensis	RchiOBHm_Chr2g0089581
rosa_roxburghii	Rroxscaffold_5G00351150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	139
Acc36I	ACCTGC	1 cut(s)	139
AccII	CGCG	1 cut(s)	10
AciI	CCGC	2 cut(s)	10, 103
AcoI	YGGCCR	1 cut(s)	167
AcsI	RAATTY	1 cut(s)	253
AfaI	GTAC	2 cut(s)	7, 21
AjnI	CCWGG	2 cut(s)	164, 212
AluBI	AGCT	3 cut(s)	16, 70, 210
AluI	AGCT	3 cut(s)	16, 70, 210
AoxI	GGCC	1 cut(s)	167
ApeKI	GCWGC	2 cut(s)	70, 73
ApoI	RAATTY	1 cut(s)	253
BalI	TGGCCA	1 cut(s)	169
BbvI	GCAGC	2 cut(s)	57, 60
BceAI	ACGGC	1 cut(s)	104
BcgI	CGANNNNNNTGC	2 cut(s)	222, 256
BciT130I	CCWGG	2 cut(s)	166, 214
BfuAI	ACCTGC	1 cut(s)	139
BisI	GCNGC	2 cut(s)	71, 74
BlsI	GCNGC	2 cut(s)	72, 75
Bme1390I	CCNGG	2 cut(s)	166, 214
BmrFI	CCNGG	2 cut(s)	166, 214
BseBI	CCWGG	2 cut(s)	166, 214
BseGI	GGATG	1 cut(s)	222
BseMII	CTCAG	1 cut(s)	157
BseXI	GCAGC	2 cut(s)	57, 60
Bsh1236I	CGCG	1 cut(s)	10
BshFI	GGCC	1 cut(s)	169
BsnI	GGCC	1 cut(s)	169
Bsp1407I	TGTACA	1 cut(s)	19
BspACI	CCGC	2 cut(s)	10, 103
BspANI	GGCC	1 cut(s)	169
BspCNI	CTCAG	1 cut(s)	156
BspFNI	CGCG	1 cut(s)	10
BspMI	ACCTGC	1 cut(s)	139
BsrGI	TGTACA	1 cut(s)	19
Bst2UI	CCWGG	2 cut(s)	166, 214
Bst6I	CTCTTC	1 cut(s)	162
BstAUI	TGTACA	1 cut(s)	19
BstDEI	CTNAG	1 cut(s)	143
BstF5I	GGATG	1 cut(s)	222
BstFNI	CGCG	1 cut(s)	10
BstNI	CCWGG	2 cut(s)	166, 214
BstSCI	CCNGG	2 cut(s)	164, 212
BstUI	CGCG	1 cut(s)	10
BstV1I	GCAGC	2 cut(s)	57, 60
BsuRI	GGCC	1 cut(s)	169
BtsCI	GGATG	1 cut(s)	222
BveI	ACCTGC	1 cut(s)	139
Csp6I	GTAC	2 cut(s)	6, 20
CviJI	RGCY	6 cut(s)	16, 70, 91, 169, 210, 231
CviKI_1	RGCY	6 cut(s)	16, 70, 91, 169, 210, 231
CviQI	GTAC	2 cut(s)	6, 20
DdeI	CTNAG	1 cut(s)	143
EaeI	YGGCCR	1 cut(s)	167
Eam1104I	CTCTTC	1 cut(s)	162
EarI	CTCTTC	1 cut(s)	162
EciI	GGCGGA	1 cut(s)	92
EcoRII	CCWGG	2 cut(s)	164, 212
FaiI	YATR	6 cut(s)	33, 140, 162, 194, 222, 239
Fnu4HI	GCNGC	2 cut(s)	71, 74
FokI	GGATG	1 cut(s)	229
Fsp4HI	GCNGC	2 cut(s)	71, 74
GluI	GCNGC	2 cut(s)	71, 74
HaeIII	GGCC	1 cut(s)	169
HindIII	AAGCTT	1 cut(s)	14
Hpy166II	GTNNAC	2 cut(s)	6, 22
Hpy188III	TCNNGA	2 cut(s)	58, 250
Hpy8I	GTNNAC	2 cut(s)	6, 22
HpyCH4V	TGCA	1 cut(s)	76
HpyF3I	CTNAG	1 cut(s)	143
LmnI	GCTCC	1 cut(s)	215
LpnPI	CCDG	7 cut(s)	43, 109, 144, 151, 178, 199, 226
Lsp1109I	GCAGC	2 cut(s)	57, 60
MboII	GAAGA	2 cut(s)	86, 149
MlsI	TGGCCA	1 cut(s)	169
MluCI	AATT	1 cut(s)	253
MluNI	TGGCCA	1 cut(s)	169
MnlI	CCTC	1 cut(s)	165
Mox20I	TGGCCA	1 cut(s)	169
MscI	TGGCCA	1 cut(s)	169
MseI	TTAA	2 cut(s)	108, 265
Msp20I	TGGCCA	1 cut(s)	169
MspR9I	CCNGG	2 cut(s)	166, 214
MvaI	CCWGG	2 cut(s)	166, 214
MvnI	CGCG	1 cut(s)	10
NmeAIII	GCCGAG	1 cut(s)	257
PaqCI	CACCTGC	1 cut(s)	139
PfoI	TCCNGGA	1 cut(s)	212
PkrI	GCNGC	2 cut(s)	72, 75
Psp6I	CCWGG	2 cut(s)	164, 212
PspGI	CCWGG	2 cut(s)	164, 212
RsaI	GTAC	2 cut(s)	7, 21
RsaNI	GTAC	2 cut(s)	6, 20
SaqAI	TTAA	2 cut(s)	108, 265
SatI	GCNGC	2 cut(s)	71, 74
ScrFI	CCNGG	2 cut(s)	166, 214
SetI	ASST	5 cut(s)	18, 72, 133, 167, 212
Sse9I	AATT	1 cut(s)	253
SsiI	CCGC	2 cut(s)	10, 103
StyD4I	CCNGG	2 cut(s)	164, 212
TaqI	TCGA	2 cut(s)	185, 249
TasI	AATT	1 cut(s)	253
TatI	WGTACW	1 cut(s)	19
Tru1I	TTAA	2 cut(s)	108, 265
Tru9I	TTAA	2 cut(s)	108, 265
TseI	GCWGC	2 cut(s)	70, 73
TspDTI	ATGAA	2 cut(s)	149, 235
XapI	RAATTY	1 cut(s)	253
XcmI	CCANNNNNNNNNTGG	2 cut(s)	54, 177

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.