pycom13g28850

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Reverse (-)
24990125 .. 24990547
423 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g28850.1

Sequence Viewer

Length: 423 bp
ATGATAATCAATCGTGCAATCGTAATCGCTGAGCAACTCCAACCACCTCCGTTGACGAAGATTAAGTTCCTTCTGAGTAAAGAGATACTGAAGACTCTTGTGATCTGTAAAGATCTTACACTTCTCTCCGTAAAGATAGTGTCTCCACAACTTCAACGCAAAGATGATAGCAGCCAACTCCAAATCATGTGTAGGGTAATTCAACTCATGGGGTTTCAACTACCGCGAAGCATAAGCAATCACCCTACCATGCTGCATCAACACACATCCCAGACCATTCAAGGAAGCATCGCTATAAACCTCGAAATCACCACAATCGTCTGGGAGTGCCAAAACAGGTGCATGAGTGAGACAATGCTTCAACTGCTGGAAACTCTGCTCACACTTATCATCCCACTCAAATTTAACATCCTTCCTCGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

141

Amino Acids

16.01

Weight (kDa)

9.3

Isoelectric Point (pI)

51.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 226
AciI CCGC 1 cut(s) 224
AcsI RAATTY 1 cut(s) 401
AcuI CTGAAG 1 cut(s) 110
AgsI TTSAA 5 cut(s) 155, 203, 218, 281, 362
Alw26I GTCTC 2 cut(s) 147, 344
ApeKI GCWGC 2 cut(s) 171, 253
ApoI RAATTY 1 cut(s) 401
AsuHPI GGTGA 2 cut(s) 233, 301
BbsI GAAGAC 1 cut(s) 98
BbvI GCAGC 2 cut(s) 183, 240
BcoDI GTCTC 2 cut(s) 147, 344
BglII AGATCT 1 cut(s) 112
BisI GCNGC 2 cut(s) 172, 254
BlpI GCTNAGC 1 cut(s) 30
BlsI GCNGC 2 cut(s) 173, 255
BmsI GCATC 2 cut(s) 265, 297
BpiI GAAGAC 1 cut(s) 98
Bpu1102I GCTNAGC 1 cut(s) 30
BseGI GGATG 3 cut(s) 266, 390, 408
BseMII CTCAG 2 cut(s) 21, 65
BseXI GCAGC 2 cut(s) 183, 240
Bsh1236I CGCG 1 cut(s) 226
BsmAI GTCTC 2 cut(s) 147, 344
Bsp143I GATC 2 cut(s) 102, 112
Bsp1720I GCTNAGC 1 cut(s) 30
BspACI CCGC 1 cut(s) 224
BspCNI CTCAG 2 cut(s) 22, 66
BspFNI CGCG 1 cut(s) 226
BssMI GATC 2 cut(s) 102, 112
BstDEI CTNAG 2 cut(s) 30, 74
BstF5I GGATG 3 cut(s) 266, 390, 408
BstFNI CGCG 1 cut(s) 226
BstKTI GATC 2 cut(s) 105, 115
BstMAI GTCTC 2 cut(s) 147, 344
BstMBI GATC 2 cut(s) 102, 112
BstMWI GCNNNNNNNGC 1 cut(s) 364
BstUI CGCG 1 cut(s) 226
BstV1I GCAGC 2 cut(s) 183, 240
BstV2I GAAGAC 1 cut(s) 98
BstX2I RGATCY 1 cut(s) 112
BstYI RGATCY 1 cut(s) 112
BtgZI GCGATG 1 cut(s) 274
BtsCI GGATG 3 cut(s) 266, 390, 408
CspCI CAANNNNNGTGG 2 cut(s) 33, 68
CviAII CATG 4 cut(s) 187, 208, 250, 343
CviJI RGCY 1 cut(s) 174
CviKI_1 RGCY 1 cut(s) 174
DdeI CTNAG 2 cut(s) 30, 74
DpnI GATC 2 cut(s) 104, 114
DpnII GATC 2 cut(s) 102, 112
Eco57I CTGAAG 1 cut(s) 110
FaeI CATG 4 cut(s) 190, 211, 253, 346
FaiI YATR 6 cut(s) 188, 209, 233, 251, 296, 344
FatI CATG 4 cut(s) 186, 207, 249, 342
Fnu4HI GCNGC 2 cut(s) 172, 254
FokI GGATG 3 cut(s) 253, 377, 395
Fsp4HI GCNGC 2 cut(s) 172, 254
GluI GCNGC 2 cut(s) 172, 254
Hin1II CATG 4 cut(s) 190, 211, 253, 346
HincII GTYRAC 1 cut(s) 54
HindII GTYRAC 1 cut(s) 54
HinfI GANTC 1 cut(s) 94
HphI GGTGA 2 cut(s) 233, 301
Hpy166II GTNNAC 1 cut(s) 54
Hpy188I TCNGA 1 cut(s) 75
Hpy8I GTNNAC 1 cut(s) 54
HpyAV CCTTC 2 cut(s) 80, 422
HpyCH4V TGCA 3 cut(s) 17, 256, 342
HpyF10VI GCNNNNNNNGC 1 cut(s) 364
HpyF3I CTNAG 2 cut(s) 30, 74
Hsp92II CATG 4 cut(s) 190, 211, 253, 346
Kzo9I GATC 2 cut(s) 102, 112
LpnPI CCDG 4 cut(s) 284, 307, 322, 353
Lsp1109I GCAGC 2 cut(s) 183, 240
LweI GCATC 2 cut(s) 265, 297
MalI GATC 2 cut(s) 104, 114
MboI GATC 2 cut(s) 102, 112
MboII GAAGA 2 cut(s) 70, 103
MflI RGATCY 1 cut(s) 112
MluCI AATT 2 cut(s) 198, 401
MlyI GAGTC 1 cut(s) 88
MmeI TCCRAC 1 cut(s) 64
MnlI CCTC 2 cut(s) 57, 311
MseI TTAA 3 cut(s) 63, 405, 421
MvnI CGCG 1 cut(s) 226
MwoI GCNNNNNNNGC 1 cut(s) 364
NdeII GATC 2 cut(s) 102, 112
NlaIII CATG 4 cut(s) 190, 211, 253, 346
PkrI GCNGC 2 cut(s) 173, 255
PleI GAGTC 1 cut(s) 88
PpsI GAGTC 1 cut(s) 88
PsuI RGATCY 1 cut(s) 112
SaqAI TTAA 3 cut(s) 63, 405, 421
SatI GCNGC 2 cut(s) 172, 254
Sau3AI GATC 2 cut(s) 102, 112
SchI GAGTC 1 cut(s) 88
SetI ASST 3 cut(s) 49, 303, 341
SfaNI GCATC 2 cut(s) 265, 297
Sse9I AATT 2 cut(s) 198, 401
SsiI CCGC 1 cut(s) 224
TaqI TCGA 1 cut(s) 303
TasI AATT 2 cut(s) 198, 401
Tru1I TTAA 3 cut(s) 63, 405, 421
Tru9I TTAA 3 cut(s) 63, 405, 421
TseI GCWGC 2 cut(s) 171, 253
TspGWI ACGGA 2 cut(s) 39, 118
XapI RAATTY 1 cut(s) 401
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.