Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000005

Orthogroup ID

OG0002049

Physical Location & Seq

Genomic Coordinates Reverse (-)

26415745 .. 26420554

Gene Structure 4810 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_5G00351150.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 222 bp

ATGATAACCGGACCTCAAATCGATCTTAGAGAAAACCTTAGCCCCCCTCAACTGATCAAACAAATCATCAATCCGAGGCAAAGGATATTTATTCTTGATGGTAACCTTATTCAACTTCCTGTAATCGATGCACAACCTCAAGGTACCATCCTTCTTCCTGACAAACAAAACCGGAGCACCCCAAGGAGACACACTAGATTGAATGAAGCCTTTATCCACTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

73

Amino Acids

8.41

Weight (kDa)

10.7

Isoelectric Point (pI)

61.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002049)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g00950 pycom01g02230 pycom01g02530 pycom01g03240 pycom01g03780 pycom01g03960 pycom01g10590 pycom02g05860 pycom02g18140 pycom02g18750 pycom02g25820 pycom03g06900 pycom03g14140 pycom04g13490 pycom05g06800 pycom05g08060 pycom05g11020 pycom06g01480 pycom07g11130 pycom08g10990 pycom08g12630 pycom08g15990 pycom09g16180 pycom10g06310 pycom11g05150 pycom11g21930 pycom12g00360 pycom12g03890 pycom12g08360 pycom13g22190 pycom13g23920 pycom13g25930 pycom13g26530 pycom13g27310 pycom13g27750 pycom13g28850 pycom15g23410 pycom15g30270 pycom15g35580 pycom16g01960 pycom17g21240 pycom420g00260 pycom808g00230
rosa_chinensis	RchiOBHm_Chr2g0089581
rosa_roxburghii	Rroxscaffold_5G00351150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	143
AccB1I	GGYRCC	1 cut(s)	143
AfaI	GTAC	1 cut(s)	145
AgsI	TTSAA	2 cut(s)	113, 202
Alw21I	GWGCWC	1 cut(s)	179
Alw26I	GTCTC	1 cut(s)	181
Asp718I	GGTACC	1 cut(s)	143
AspS9I	GGNCC	1 cut(s)	11
AvaII	GGWCC	1 cut(s)	11
BanI	GGYRCC	1 cut(s)	143
Bbv12I	GWGCWC	1 cut(s)	179
BccI	CCATC	2 cut(s)	92, 155
BclI	TGATCA	1 cut(s)	54
BcoDI	GTCTC	1 cut(s)	181
BfaI	CTAG	1 cut(s)	195
Bme18I	GGWCC	1 cut(s)	11
BmgT120I	GGNCC	1 cut(s)	11
BmiI	GGNNCC	1 cut(s)	145
BmsI	GCATC	1 cut(s)	118
Bpu10I	CCTNAGC	1 cut(s)	38
BpuEI	CTTGAG	1 cut(s)	123
Bsa29I	ATCGAT	2 cut(s)	21, 126
BsaJI	CCNNGG	2 cut(s)	74, 182
BsaWI	WCCGGW	2 cut(s)	8, 171
BseCI	ATCGAT	2 cut(s)	21, 126
BseDI	CCNNGG	2 cut(s)	74, 182
BseGI	GGATG	1 cut(s)	147
BshNI	GGYRCC	1 cut(s)	143
BshVI	ATCGAT	2 cut(s)	21, 126
BsiHKAI	GWGCWC	1 cut(s)	179
BsiSI	CCGG	2 cut(s)	9, 172
BsmAI	GTCTC	1 cut(s)	181
Bsp1286I	GDGCHC	1 cut(s)	179
Bsp143I	GATC	2 cut(s)	22, 54
BspDI	ATCGAT	2 cut(s)	21, 126
BspLI	GGNNCC	1 cut(s)	145
BspT107I	GGYRCC	1 cut(s)	143
BssECI	CCNNGG	2 cut(s)	74, 182
BssMI	GATC	2 cut(s)	22, 54
BssT1I	CCWWGG	1 cut(s)	182
BstDEI	CTNAG	2 cut(s)	26, 38
BstEII	GGTNACC	1 cut(s)	101
BstF5I	GGATG	1 cut(s)	147
BstKTI	GATC	2 cut(s)	25, 57
BstMAI	GTCTC	1 cut(s)	181
BstMBI	GATC	2 cut(s)	22, 54
BstPI	GGTNACC	1 cut(s)	101
Bsu15I	ATCGAT	2 cut(s)	21, 126
BsuTUI	ATCGAT	2 cut(s)	21, 126
BtsCI	GGATG	1 cut(s)	147
Cfr13I	GGNCC	1 cut(s)	11
ClaI	ATCGAT	2 cut(s)	21, 126
Csp6I	GTAC	1 cut(s)	144
CviJI	RGCY	2 cut(s)	42, 209
CviKI_1	RGCY	2 cut(s)	42, 209
CviQI	GTAC	1 cut(s)	144
DdeI	CTNAG	2 cut(s)	26, 38
DpnI	GATC	2 cut(s)	24, 56
DpnII	GATC	2 cut(s)	22, 54
Eco130I	CCWWGG	1 cut(s)	182
Eco47I	GGWCC	1 cut(s)	11
Eco91I	GGTNACC	1 cut(s)	101
EcoO65I	GGTNACC	1 cut(s)	101
EcoT14I	CCWWGG	1 cut(s)	182
ErhI	CCWWGG	1 cut(s)	182
FbaI	TGATCA	1 cut(s)	54
FokI	GGATG	1 cut(s)	134
FspBI	CTAG	1 cut(s)	195
HapII	CCGG	2 cut(s)	9, 172
HpaII	CCGG	2 cut(s)	9, 172
Hpy188I	TCNGA	1 cut(s)	75
Hpy188III	TCNNGA	2 cut(s)	95, 158
HpyAV	CCTTC	1 cut(s)	161
HpyCH4V	TGCA	1 cut(s)	131
HpyF3I	CTNAG	2 cut(s)	26, 38
KpnI	GGTACC	1 cut(s)	147
Ksp22I	TGATCA	1 cut(s)	54
Kzo9I	GATC	2 cut(s)	22, 54
LmnI	GCTCC	1 cut(s)	174
LpnPI	CCDG	4 cut(s)	22, 132, 171, 185
LweI	GCATC	1 cut(s)	118
MaeI	CTAG	1 cut(s)	195
MaeIII	GTNAC	1 cut(s)	101
MalI	GATC	2 cut(s)	24, 56
MboI	GATC	2 cut(s)	22, 54
MboII	GAAGA	1 cut(s)	146
MhlI	GDGCHC	1 cut(s)	179
MnlI	CCTC	4 cut(s)	24, 57, 69, 147
MspI	CCGG	2 cut(s)	9, 172
NdeII	GATC	2 cut(s)	22, 54
NlaIV	GGNNCC	1 cut(s)	145
PspEI	GGTNACC	1 cut(s)	101
PspN4I	GGNNCC	1 cut(s)	145
PspPI	GGNCC	1 cut(s)	11
RsaI	GTAC	1 cut(s)	145
RsaNI	GTAC	1 cut(s)	144
Sau3AI	GATC	2 cut(s)	22, 54
Sau96I	GGNCC	1 cut(s)	11
SduI	GDGCHC	1 cut(s)	179
SetI	ASST	5 cut(s)	16, 39, 108, 139, 145
SfaNI	GCATC	1 cut(s)	118
SgeI	CNNG	9 cut(s)	21, 87, 107, 131, 152, 170, 184, 195, 207
SinI	GGWCC	1 cut(s)	11
SmlI	CTYRAG	1 cut(s)	138
SmoI	CTYRAG	1 cut(s)	138
SspMI	CTAG	1 cut(s)	195
StyI	CCWWGG	1 cut(s)	182
TaqI	TCGA	2 cut(s)	21, 126
TspDTI	ATGAA	1 cut(s)	219
VpaK11BI	GGWCC	1 cut(s)	11
XspI	CTAG	1 cut(s)	195

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.