Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr10

Orthogroup ID

OG0002049

Physical Location & Seq

Genomic Coordinates Forward (+)

7249573 .. 7250013

Gene Structure 441 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom10g06310.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 441 bp

ATGTCGAACATGCTCCGCTTTGGACTTAGAATACACCAGAATATCGTCAATGAAGACAATAACAAATCTATCCAAGTAAGGCTGGAACACCCGATTCATCAAATCCATGAAGGCGGCTGGTGCATTCGTCAACCCAAATGGCATAACCAGAAACTCGTAATGACCGTAACGAGTCCTGAACGCCGTCTTAGGGACATCATCCCTACTGATCTTCAGCTGATAGTAACCAGACCTCAAGTCTATCTTAGAAAACACACAAGCACCTCTCAGCTGATCGAACAAATCATCGATACGAGGCAATGGATAACGGTTTTTAATCGTCACCCGATTCAATTGCCTGTAGTCGATGCACAGCCTCAAAGTTCCATCCTTCTTCCTCACAAACAGAACTGGAGCGCCCCAAGGCGAAGTACTAGGCTGAATAAATCCCTTATCCACTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

147

Amino Acids

17.3

Weight (kDa)

11.09

Isoelectric Point (pI)

71.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002049)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g00950 pycom01g02230 pycom01g02530 pycom01g03240 pycom01g03780 pycom01g03960 pycom01g10590 pycom02g05860 pycom02g18140 pycom02g18750 pycom02g25820 pycom03g06900 pycom03g14140 pycom04g13490 pycom05g06800 pycom05g08060 pycom05g11020 pycom06g01480 pycom07g11130 pycom08g10990 pycom08g12630 pycom08g15990 pycom09g16180 pycom10g06310 pycom11g05150 pycom11g21930 pycom12g00360 pycom12g03890 pycom12g08360 pycom13g22190 pycom13g23920 pycom13g25930 pycom13g26530 pycom13g27310 pycom13g27750 pycom13g28850 pycom15g23410 pycom15g30270 pycom15g35580 pycom16g01960 pycom17g21240 pycom420g00260 pycom808g00230
rosa_chinensis	RchiOBHm_Chr2g0089581
rosa_roxburghii	Rroxscaffold_5G00351150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	16, 114
AcuI	CTGAAG	1 cut(s)	197
AfaI	GTAC	1 cut(s)	412
AfiI	CCNNNNNNNGG	1 cut(s)	190
AgsI	TTSAA	1 cut(s)	332
AhdI	GACNNNNNGTC	1 cut(s)	236
AluBI	AGCT	2 cut(s)	217, 271
AluI	AGCT	2 cut(s)	217, 271
AspLEI	GCGC	1 cut(s)	398
AsuHPI	GGTGA	1 cut(s)	314
BbsI	GAAGAC	1 cut(s)	60
BccI	CCATC	1 cut(s)	374
BceAI	ACGGC	1 cut(s)	168
BcgI	CGANNNNNNTGC	2 cut(s)	316, 350
BfaI	CTAG	1 cut(s)	414
BfmI	CTRYAG	1 cut(s)	339
BfoI	RGCGCY	1 cut(s)	399
BisI	GCNGC	1 cut(s)	115
BlsI	GCNGC	1 cut(s)	116
BmcAI	AGTACT	1 cut(s)	412
BmeRI	GACNNNNNGTC	1 cut(s)	236
BmsI	GCATC	1 cut(s)	337
BpiI	GAAGAC	1 cut(s)	60
BpmI	CTGGAG	1 cut(s)	412
BpuEI	CTTGAG	1 cut(s)	219
Bsa29I	ATCGAT	1 cut(s)	288
BsaJI	CCNNGG	1 cut(s)	401
Bsc4I	CCNNNNNNNGG	1 cut(s)	190
Bse1I	ACTGG	1 cut(s)	395
Bse3DI	GCAATG	1 cut(s)	305
BseCI	ATCGAT	1 cut(s)	288
BseDI	CCNNGG	1 cut(s)	401
BseGI	GGATG	2 cut(s)	198, 366
BseLI	CCNNNNNNNGG	1 cut(s)	190
BseMI	GCAATG	1 cut(s)	305
BseMII	CTCAG	1 cut(s)	281
BseNI	ACTGG	1 cut(s)	395
BshVI	ATCGAT	1 cut(s)	288
BslFI	GGGAC	1 cut(s)	206
BslI	CCNNNNNNNGG	1 cut(s)	190
BsmFI	GGGAC	1 cut(s)	206
BsmI	GAATGC	1 cut(s)	123
Bsp143I	GATC	2 cut(s)	208, 273
BspACI	CCGC	2 cut(s)	16, 114
BspCNI	CTCAG	1 cut(s)	280
BspDI	ATCGAT	1 cut(s)	288
BsrDI	GCAATG	1 cut(s)	305
BsrI	ACTGG	1 cut(s)	395
BssECI	CCNNGG	1 cut(s)	401
BssMI	GATC	2 cut(s)	208, 273
BssT1I	CCWWGG	1 cut(s)	401
Bst4CI	ACNGT	2 cut(s)	166, 310
BstDEI	CTNAG	4 cut(s)	26, 188, 245, 267
BstF5I	GGATG	2 cut(s)	198, 366
BstH2I	RGCGCY	1 cut(s)	399
BstHHI	GCGC	1 cut(s)	398
BstKTI	GATC	2 cut(s)	211, 276
BstMBI	GATC	2 cut(s)	208, 273
BstMWI	GCNNNNNNNGC	1 cut(s)	120
BstNSI	RCATGY	1 cut(s)	13
BstSFI	CTRYAG	1 cut(s)	339
BstV2I	GAAGAC	1 cut(s)	60
Bsu15I	ATCGAT	1 cut(s)	288
BsuTUI	ATCGAT	1 cut(s)	288
BtsCI	GGATG	2 cut(s)	198, 366
CfoI	GCGC	1 cut(s)	398
ClaI	ATCGAT	1 cut(s)	288
Csp6I	GTAC	1 cut(s)	411
CviAII	CATG	2 cut(s)	10, 107
CviJI	RGCY	6 cut(s)	82, 117, 217, 271, 355, 418
CviKI_1	RGCY	6 cut(s)	82, 117, 217, 271, 355, 418
CviQI	GTAC	1 cut(s)	411
DdeI	CTNAG	4 cut(s)	26, 188, 245, 267
DpnI	GATC	2 cut(s)	210, 275
DpnII	GATC	2 cut(s)	208, 273
DriI	GACNNNNNGTC	1 cut(s)	236
Eam1105I	GACNNNNNGTC	1 cut(s)	236
Eco130I	CCWWGG	1 cut(s)	401
Eco57I	CTGAAG	1 cut(s)	197
EcoT14I	CCWWGG	1 cut(s)	401
ErhI	CCWWGG	1 cut(s)	401
FaeI	CATG	2 cut(s)	13, 110
FaiI	YATR	3 cut(s)	11, 108, 144
FalI	AAGNNNNNCTT	2 cut(s)	228, 260
FaqI	GGGAC	1 cut(s)	206
FatI	CATG	2 cut(s)	9, 106
Fnu4HI	GCNGC	1 cut(s)	115
FokI	GGATG	2 cut(s)	185, 353
Fsp4HI	GCNGC	1 cut(s)	115
FspBI	CTAG	1 cut(s)	414
GlaI	GCGC	1 cut(s)	397
GluI	GCNGC	1 cut(s)	115
GsuI	CTGGAG	1 cut(s)	412
HaeII	RGCGCY	1 cut(s)	399
HhaI	GCGC	1 cut(s)	398
Hin1II	CATG	2 cut(s)	13, 110
Hin6I	GCGC	1 cut(s)	396
HinP1I	GCGC	1 cut(s)	396
HincII	GTYRAC	1 cut(s)	131
HindII	GTYRAC	1 cut(s)	131
HinfI	GANTC	3 cut(s)	94, 172, 328
HphI	GGTGA	1 cut(s)	314
Hpy166II	GTNNAC	1 cut(s)	131
Hpy188III	TCNNGA	1 cut(s)	176
Hpy8I	GTNNAC	1 cut(s)	131
HpyAV	CCTTC	2 cut(s)	104, 380
HpyCH4III	ACNGT	2 cut(s)	166, 310
HpyCH4V	TGCA	2 cut(s)	123, 350
HpyF10VI	GCNNNNNNNGC	1 cut(s)	120
HpyF3I	CTNAG	4 cut(s)	26, 188, 245, 267
Hsp92II	CATG	2 cut(s)	13, 110
HspAI	GCGC	1 cut(s)	396
Kzo9I	GATC	2 cut(s)	208, 273
LmnI	GCTCC	2 cut(s)	18, 393
LpnPI	CCDG	8 cut(s)	50, 68, 103, 161, 189, 241, 351, 376
LweI	GCATC	1 cut(s)	337
MaeI	CTAG	1 cut(s)	414
MaeIII	GTNAC	3 cut(s)	166, 223, 320
MalI	GATC	2 cut(s)	210, 275
MboI	GATC	2 cut(s)	208, 273
MboII	GAAGA	3 cut(s)	65, 203, 365
MfeI	CAATTG	1 cut(s)	332
MluCI	AATT	1 cut(s)	332
MlyI	GAGTC	1 cut(s)	181
MnlI	CCTC	5 cut(s)	243, 274, 288, 366, 387
MseI	TTAA	1 cut(s)	315
MspA1I	CMGCKG	2 cut(s)	217, 271
MunI	CAATTG	1 cut(s)	332
Mva1269I	GAATGC	1 cut(s)	123
MwoI	GCNNNNNNNGC	1 cut(s)	120
NdeII	GATC	2 cut(s)	208, 273
NlaIII	CATG	2 cut(s)	13, 110
NmuCI	GTSAC	1 cut(s)	320
NspI	RCATGY	1 cut(s)	13
PcsI	WCGNNNNNNNCGW	1 cut(s)	162
PctI	GAATGC	1 cut(s)	123
PfeI	GAWTC	2 cut(s)	94, 328
PkrI	GCNGC	1 cut(s)	116
PleI	GAGTC	1 cut(s)	180
PpsI	GAGTC	1 cut(s)	180
PvuII	CAGCTG	2 cut(s)	217, 271
RsaI	GTAC	1 cut(s)	412
RsaNI	GTAC	1 cut(s)	411
SaqAI	TTAA	1 cut(s)	315
SatI	GCNGC	1 cut(s)	115
Sau3AI	GATC	2 cut(s)	208, 273
ScaI	AGTACT	1 cut(s)	412
SchI	GAGTC	1 cut(s)	181
SetI	ASST	4 cut(s)	219, 235, 266, 273
SfaNI	GCATC	1 cut(s)	337
SfcI	CTRYAG	1 cut(s)	339
SmlI	CTYRAG	1 cut(s)	234
SmoI	CTYRAG	1 cut(s)	234
Sse9I	AATT	1 cut(s)	332
SsiI	CCGC	2 cut(s)	16, 114
SspMI	CTAG	1 cut(s)	414
StyI	CCWWGG	1 cut(s)	401
TaaI	ACNGT	2 cut(s)	166, 310
TaqI	TCGA	4 cut(s)	5, 276, 288, 345
TasI	AATT	1 cut(s)	332
TatI	WGTACW	1 cut(s)	410
TauI	GCSGC	1 cut(s)	117
TfiI	GAWTC	2 cut(s)	94, 328
Tru1I	TTAA	1 cut(s)	315
Tru9I	TTAA	1 cut(s)	315
TseFI	GTSAC	1 cut(s)	320
Tsp45I	GTSAC	1 cut(s)	320
TspDTI	ATGAA	3 cut(s)	66, 86, 123
XceI	RCATGY	1 cut(s)	13
XspI	CTAG	1 cut(s)	414
ZrmI	AGTACT	1 cut(s)	412

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.