pycom08g04070

ubiquitin-protein transferase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0002872
Physical Location & Seq
Forward (+)
3107985 .. 3109644
1660 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 282 bp
ATGCCCACACCTATAAAACCACCCCGGAGACATTTCCCAGTTTTCCGGCGAGCACCGCCCCTTTCGAGGCAATTTCCGGCCAAACCACGGCGAGTTGGCTGGCGTGCTAGTTTTCCGGCGGACACCCGTGGCTTCCAGGCTGTTTTCCGGCCAACTCCGACCACGATGACGGGAACCAAGGGGCGATTATCTGTGGCGTTTCCTTCTTCGCTAGATGGCGTGGCTTTTCGACGGCGAAGTACTATGAGACTTAGAATCGAGGCATACAATCCCGACGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.62

Weight (kDa)

12.0

Isoelectric Point (pI)

75.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 279
AciI CCGC 2 cut(s) 56, 119
AcoI YGGCCR 2 cut(s) 78, 149
AcyI GRCGYC 1 cut(s) 276
AfaI GTAC 1 cut(s) 241
AfiI CCNNNNNNNGG 2 cut(s) 66, 87
AjnI CCWGG 1 cut(s) 135
Alw21I GWGCWC 1 cut(s) 55
Alw26I GTCTC 2 cut(s) 22, 241
AoxI GGCC 2 cut(s) 78, 149
AsuC2I CCSGG 1 cut(s) 25
Bbv12I GWGCWC 1 cut(s) 55
BccI CCATC 1 cut(s) 209
BceAI ACGGC 2 cut(s) 104, 248
BciT130I CCWGG 1 cut(s) 137
BcnI CCSGG 1 cut(s) 25
BcoDI GTCTC 2 cut(s) 22, 241
BfaI CTAG 3 cut(s) 108, 212, 280
BmcAI AGTACT 1 cut(s) 241
Bme1390I CCNGG 2 cut(s) 25, 137
BmiI GGNNCC 1 cut(s) 175
BmrFI CCNGG 2 cut(s) 25, 137
BmrI ACTGGG 1 cut(s) 32
BmuI ACTGGG 1 cut(s) 32
BpuMI CCSGG 1 cut(s) 25
BsaHI GRCGYC 1 cut(s) 276
BsaJI CCNNGG 4 cut(s) 23, 86, 127, 177
Bsc4I CCNNNNNNNGG 2 cut(s) 66, 87
Bse1I ACTGG 1 cut(s) 38
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 4 cut(s) 23, 86, 127, 177
BseLI CCNNNNNNNGG 2 cut(s) 66, 87
BseNI ACTGG 1 cut(s) 38
BshFI GGCC 2 cut(s) 80, 151
BsiHKAI GWGCWC 1 cut(s) 55
BsiSI CCGG 5 cut(s) 25, 46, 77, 116, 148
BslI CCNNNNNNNGG 2 cut(s) 66, 87
BsmAI GTCTC 2 cut(s) 22, 241
BsnI GGCC 2 cut(s) 80, 151
Bsp1286I GDGCHC 1 cut(s) 55
BspACI CCGC 2 cut(s) 56, 119
BspANI GGCC 2 cut(s) 80, 151
BspLI GGNNCC 1 cut(s) 175
BsrI ACTGG 1 cut(s) 38
BssECI CCNNGG 4 cut(s) 23, 86, 127, 177
BssNI GRCGYC 1 cut(s) 276
BssT1I CCWWGG 1 cut(s) 177
Bst2UI CCWGG 1 cut(s) 137
BstACI GRCGYC 1 cut(s) 276
BstC8I GCNNGC 3 cut(s) 51, 101, 105
BstDEI CTNAG 1 cut(s) 251
BstDSI CCRYGG 2 cut(s) 86, 127
BstMAI GTCTC 2 cut(s) 22, 241
BstMWI GCNNNNNNNGC 1 cut(s) 55
BstNI CCWGG 1 cut(s) 137
BstSCI CCNGG 2 cut(s) 23, 135
BsuRI GGCC 2 cut(s) 80, 151
BtgI CCRYGG 2 cut(s) 86, 127
Cac8I GCNNGC 3 cut(s) 51, 101, 105
Csp6I GTAC 1 cut(s) 240
CviJI RGCY 6 cut(s) 80, 99, 132, 140, 151, 224
CviKI_1 RGCY 6 cut(s) 80, 99, 132, 140, 151, 224
CviQI GTAC 1 cut(s) 240
DdeI CTNAG 1 cut(s) 251
EaeI YGGCCR 2 cut(s) 78, 149
EciI GGCGGA 1 cut(s) 134
Eco130I CCWWGG 1 cut(s) 177
EcoRII CCWGG 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 177
ErhI CCWWGG 1 cut(s) 177
FaiI YATR 3 cut(s) 14, 245, 265
FspBI CTAG 3 cut(s) 108, 212, 280
HaeIII GGCC 2 cut(s) 80, 151
HapII CCGG 5 cut(s) 25, 46, 77, 116, 148
Hin1I GRCGYC 1 cut(s) 276
HinfI GANTC 1 cut(s) 255
HpaII CCGG 5 cut(s) 25, 46, 77, 116, 148
Hpy188I TCNGA 1 cut(s) 159
Hpy188III TCNNGA 1 cut(s) 272
Hpy99I CGWCG 2 cut(s) 234, 278
HpyAV CCTTC 1 cut(s) 213
HpyCH4IV ACGT 1 cut(s) 276
HpyF10VI GCNNNNNNNGC 1 cut(s) 55
HpyF3I CTNAG 1 cut(s) 251
HpySE526I ACGT 1 cut(s) 276
Hsp92I GRCGYC 1 cut(s) 276
LpnPI CCDG 9 cut(s) 38, 51, 59, 85, 90, 122, 129, 149, 161
MaeI CTAG 3 cut(s) 108, 212, 280
MaeII ACGT 1 cut(s) 276
MboII GAAGA 1 cut(s) 198
MhlI GDGCHC 1 cut(s) 55
MluCI AATT 1 cut(s) 71
MmeI TCCRAC 1 cut(s) 182
MnlI CCTC 2 cut(s) 60, 253
MspI CCGG 5 cut(s) 25, 46, 77, 116, 148
MspR9I CCNGG 2 cut(s) 25, 137
MvaI CCWGG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 55
NciI CCSGG 1 cut(s) 25
NlaIV GGNNCC 1 cut(s) 175
PfeI GAWTC 1 cut(s) 255
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PspN4I GGNNCC 1 cut(s) 175
RsaI GTAC 1 cut(s) 241
RsaNI GTAC 1 cut(s) 240
ScaI AGTACT 1 cut(s) 241
ScrFI CCNGG 2 cut(s) 25, 137
SduI GDGCHC 1 cut(s) 55
SetI ASST 2 cut(s) 13, 279
Sse9I AATT 1 cut(s) 71
SsiI CCGC 2 cut(s) 56, 119
SspMI CTAG 3 cut(s) 108, 212, 280
StyD4I CCNGG 2 cut(s) 23, 135
StyI CCWWGG 1 cut(s) 177
TaiI ACGT 1 cut(s) 279
TaqI TCGA 3 cut(s) 65, 229, 258
TasI AATT 1 cut(s) 71
TatI WGTACW 1 cut(s) 239
TfiI GAWTC 1 cut(s) 255
XspI CTAG 3 cut(s) 108, 212, 280
ZraI GACGTC 1 cut(s) 277
ZrmI AGTACT 1 cut(s) 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.