pycom10g20470

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
23338900 .. 23339243
344 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g20470.1

Sequence Viewer

Length: 288 bp
ATGTGTAATAAGGAGGGTAGTGAGATTGACTACATAATTTGTAATATGGGTTTAATGACTTATAAAATTGCAATTTCAAAGATCTTAAATTACATTGAAAATTGTTATTACTGTGATTGTGCAGTGCTTACTATGTATTTGCTTAGCTTAATTATAAATTACGGGTGGTTGCAAGTTAGAATTTTATTCATGCAGAGAAGTGTATCTCATTACAAGGAACTCAATCCAACAGAATATTTACTACTTTTAAAAACATTTTGTGAACTCCAAGCTCAAGTCAATCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

11.2

Weight (kDa)

5.68

Isoelectric Point (pI)

46.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 63, 155
AcsI RAATTY 1 cut(s) 180
AgsI TTSAA 2 cut(s) 78, 98
AluBI AGCT 2 cut(s) 147, 272
AluI AGCT 2 cut(s) 147, 272
ApoI RAATTY 1 cut(s) 180
BglII AGATCT 1 cut(s) 81
BlpI GCTNAGC 1 cut(s) 143
Bpu1102I GCTNAGC 1 cut(s) 143
BpuEI CTTGAG 1 cut(s) 258
BsgI GTGCAG 1 cut(s) 141
Bsp143I GATC 1 cut(s) 81
Bsp1720I GCTNAGC 1 cut(s) 143
BssMI GATC 1 cut(s) 81
Bst4CI ACNGT 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 143
BstKTI GATC 1 cut(s) 84
BstMBI GATC 1 cut(s) 81
BstX2I RGATCY 1 cut(s) 81
BstYI RGATCY 1 cut(s) 81
BtsI GCAGTG 1 cut(s) 129
BtsIMutI CAGTG 1 cut(s) 129
CviAII CATG 1 cut(s) 190
CviJI RGCY 2 cut(s) 147, 272
CviKI_1 RGCY 2 cut(s) 147, 272
DdeI CTNAG 1 cut(s) 143
DpnI GATC 1 cut(s) 83
DpnII GATC 1 cut(s) 81
DraI TTTAAA 1 cut(s) 249
FaeI CATG 1 cut(s) 193
FaiI YATR 6 cut(s) 35, 47, 63, 134, 155, 191
FalI AAGNNNNNCTT 1 cut(s) 267
FatI CATG 1 cut(s) 189
FspEI CC 8 cut(s) 32, 33, 147, 148, 151, 200, 240, 281
Hin1II CATG 1 cut(s) 193
Hpy166II GTNNAC 1 cut(s) 263
Hpy8I GTNNAC 1 cut(s) 263
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 4 cut(s) 71, 122, 172, 193
HpyF3I CTNAG 1 cut(s) 143
Hsp92II CATG 1 cut(s) 193
Kzo9I GATC 1 cut(s) 81
MalI GATC 1 cut(s) 83
MboI GATC 1 cut(s) 81
MflI RGATCY 1 cut(s) 81
MluCI AATT 8 cut(s) 36, 66, 72, 88, 100, 150, 157, 180
MmeI TCCRAC 1 cut(s) 251
MnlI CCTC 1 cut(s) 7
MseI TTAA 5 cut(s) 53, 86, 149, 248, 286
NdeII GATC 1 cut(s) 81
NlaIII CATG 1 cut(s) 193
PsiI TTATAA 2 cut(s) 63, 155
PsuI RGATCY 1 cut(s) 81
SaqAI TTAA 5 cut(s) 53, 86, 149, 248, 286
Sau3AI GATC 1 cut(s) 81
SetI ASST 2 cut(s) 149, 274
SgeI CNNG 5 cut(s) 175, 185, 202, 226, 281
SmlI CTYRAG 1 cut(s) 273
SmoI CTYRAG 1 cut(s) 273
Sse9I AATT 8 cut(s) 36, 66, 72, 88, 100, 150, 157, 180
SspI AATATT 1 cut(s) 236
TaaI ACNGT 1 cut(s) 113
TasI AATT 8 cut(s) 36, 66, 72, 88, 100, 150, 157, 180
Tru1I TTAA 5 cut(s) 53, 86, 149, 248, 286
Tru9I TTAA 5 cut(s) 53, 86, 149, 248, 286
TscAI CASTG 1 cut(s) 129
TspDTI ATGAA 1 cut(s) 178
TspRI CASTG 1 cut(s) 129
XapI RAATTY 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.