pycom111g04280

Belongs to the MIP aquaporin (TC 1.A.8) family

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_111
Physical Location & Seq
Reverse (-)
2595070 .. 2595252
183 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGAACCCAGCAAGGACAATAGGGCCAGCAATTACTAGTGCATACTACAAAGGAATATGGGACTACGTCGTTGAACCAGTGATAGGAGCCCTACTTGGCTCATGGTCCTACAGCTTCATTTGGGTCAGCGATAACCCGATCCAGGCAGTATCACCACCCTCATTCGCATCCAAGCTTCGTTGA

Protein Analysis

61

Amino Acids

6.59

Weight (kDa)

8.1

Isoelectric Point (pI)

33.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MIP PF00230 1 - 37 2e-08 Major intrinsic protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 133
AfiI CCNNNNNNNGG 2 cut(s) 83, 142
AgsI TTSAA 1 cut(s) 74
AhlI ACTAGT 1 cut(s) 35
AjnI CCWGG 1 cut(s) 141
AluBI AGCT 2 cut(s) 114, 175
AluI AGCT 2 cut(s) 114, 175
AlwI GGATC 1 cut(s) 133
AoxI GGCC 1 cut(s) 23
AspS9I GGNCC 2 cut(s) 23, 105
AsuHPI GGTGA 1 cut(s) 144
AvaII GGWCC 1 cut(s) 105
BanII GRGCYC 1 cut(s) 91
BciT130I CCWGG 1 cut(s) 143
BcuI ACTAGT 1 cut(s) 35
BfaI CTAG 1 cut(s) 36
BfmI CTRYAG 1 cut(s) 109
Bme1390I CCNGG 1 cut(s) 143
Bme18I GGWCC 1 cut(s) 105
BmgT120I GGNCC 2 cut(s) 23, 105
BmiI GGNNCC 1 cut(s) 88
BmrFI CCNGG 1 cut(s) 143
BmsI GCATC 1 cut(s) 176
Bsc4I CCNNNNNNNGG 2 cut(s) 83, 142
Bse1I ACTGG 1 cut(s) 77
BseBI CCWGG 1 cut(s) 143
BseGI GGATG 1 cut(s) 167
BseLI CCNNNNNNNGG 2 cut(s) 83, 142
BseNI ACTGG 1 cut(s) 77
BseYI CCCAGC 1 cut(s) 7
BshFI GGCC 1 cut(s) 25
BslFI GGGAC 1 cut(s) 74
BslI CCNNNNNNNGG 2 cut(s) 83, 142
BsmFI GGGAC 1 cut(s) 74
BsnI GGCC 1 cut(s) 25
Bsp1286I GDGCHC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 138
BspANI GGCC 1 cut(s) 25
BspLI GGNNCC 1 cut(s) 88
BspPI GGATC 1 cut(s) 133
BsrI ACTGG 1 cut(s) 77
BssMI GATC 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 27
BstF5I GGATG 1 cut(s) 167
BstKTI GATC 1 cut(s) 141
BstMBI GATC 1 cut(s) 138
BstNI CCWGG 1 cut(s) 143
BstSCI CCNGG 1 cut(s) 141
BstSFI CTRYAG 1 cut(s) 109
BsuRI GGCC 1 cut(s) 25
BtsCI GGATG 1 cut(s) 167
BtsIMutI CAGTG 1 cut(s) 84
Cac8I GCNNGC 1 cut(s) 27
Cfr13I GGNCC 2 cut(s) 23, 105
CviAII CATG 1 cut(s) 102
CviJI RGCY 5 cut(s) 25, 89, 99, 114, 175
CviKI_1 RGCY 5 cut(s) 25, 89, 99, 114, 175
DpnI GATC 1 cut(s) 140
DpnII GATC 1 cut(s) 138
Eco24I GRGCYC 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 105
EcoRII CCWGG 1 cut(s) 141
EcoT38I GRGCYC 1 cut(s) 91
FaeI CATG 1 cut(s) 105
FaiI YATR 3 cut(s) 43, 58, 103
FaqI GGGAC 1 cut(s) 74
FatI CATG 1 cut(s) 101
FokI GGATG 1 cut(s) 154
FriOI GRGCYC 1 cut(s) 91
FspBI CTAG 1 cut(s) 36
GsaI CCCAGC 1 cut(s) 11
HaeIII GGCC 1 cut(s) 25
Hin1II CATG 1 cut(s) 105
HindIII AAGCTT 1 cut(s) 173
HphI GGTGA 1 cut(s) 144
Hpy99I CGWCG 1 cut(s) 71
HpyCH4IV ACGT 1 cut(s) 66
HpyCH4V TGCA 1 cut(s) 41
HpySE526I ACGT 1 cut(s) 66
Hsp92II CATG 1 cut(s) 105
Kzo9I GATC 1 cut(s) 138
LmnI GCTCC 1 cut(s) 86
LpnPI CCDG 5 cut(s) 21, 39, 90, 128, 155
LweI GCATC 1 cut(s) 176
MaeI CTAG 1 cut(s) 36
MaeII ACGT 1 cut(s) 66
MalI GATC 1 cut(s) 140
MboI GATC 1 cut(s) 138
MhlI GDGCHC 1 cut(s) 91
MluCI AATT 1 cut(s) 30
MnlI CCTC 1 cut(s) 169
MspR9I CCNGG 1 cut(s) 143
MvaI CCWGG 1 cut(s) 143
NdeII GATC 1 cut(s) 138
NlaIII CATG 1 cut(s) 105
NlaIV GGNNCC 1 cut(s) 88
PflFI GACNNNGTC 1 cut(s) 65
Psp6I CCWGG 1 cut(s) 141
PspFI CCCAGC 1 cut(s) 7
PspGI CCWGG 1 cut(s) 141
PspN4I GGNNCC 1 cut(s) 88
PspPI GGNCC 2 cut(s) 23, 105
PsyI GACNNNGTC 1 cut(s) 65
Sau3AI GATC 1 cut(s) 138
Sau96I GGNCC 2 cut(s) 23, 105
ScrFI CCNGG 1 cut(s) 143
SduI GDGCHC 1 cut(s) 91
SetI ASST 3 cut(s) 69, 116, 177
SfaNI GCATC 1 cut(s) 176
SfcI CTRYAG 1 cut(s) 109
SinI GGWCC 1 cut(s) 105
SpeI ACTAGT 1 cut(s) 35
Sse9I AATT 1 cut(s) 30
SspMI CTAG 1 cut(s) 36
StyD4I CCNGG 1 cut(s) 141
TaiI ACGT 1 cut(s) 69
TasI AATT 1 cut(s) 30
TscAI CASTG 1 cut(s) 84
TspDTI ATGAA 2 cut(s) 17, 106
TspRI CASTG 1 cut(s) 84
Tth111I GACNNNGTC 1 cut(s) 65
VpaK11BI GGWCC 1 cut(s) 105
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.