Rmu_co8437903.1_g000001

Belongs to the MIP aquaporin (TC 1.A.8) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8437903.1
Physical Location & Seq
Reverse (-)
1 .. 869
869 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8437903.1_g000001.1.cds

Sequence Viewer

Length: 207 bp
atgaacccagccagaacattaggaccagcacttgctagtgcatactacaagggaatttgggtctatgtggtaggacctgtgataggaaccctactaggggcatggacctacaacttcattcgggtcactgacaagccggttcagggcataccaccgcactcattttcattcaagctacggagaatgaagatcgaaaatgatcggcag

Protein Analysis

69

Amino Acids

7.81

Weight (kDa)

10.2

Isoelectric Point (pI)

21.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 155
AcsI RAATTY 1 cut(s) 54
AfiI CCNNNNNNNGG 4 cut(s) 83, 96, 97, 143
AgsI TTSAA 1 cut(s) 172
AluBI AGCT 1 cut(s) 175
AluI AGCT 1 cut(s) 175
ApoI RAATTY 1 cut(s) 54
AspS9I GGNCC 3 cut(s) 23, 74, 105
AvaII GGWCC 3 cut(s) 23, 74, 105
BfaI CTAG 2 cut(s) 36, 95
Bme18I GGWCC 3 cut(s) 23, 74, 105
BmgT120I GGNCC 3 cut(s) 23, 74, 105
BmiI GGNNCC 1 cut(s) 88
Bsc4I CCNNNNNNNGG 4 cut(s) 83, 96, 97, 143
Bse118I RCCGGY 1 cut(s) 136
BseLI CCNNNNNNNGG 4 cut(s) 83, 96, 97, 143
BseYI CCCAGC 1 cut(s) 7
BsiSI CCGG 1 cut(s) 137
BslI CCNNNNNNNGG 4 cut(s) 83, 96, 97, 143
Bsp143I GATC 2 cut(s) 189, 199
BspACI CCGC 1 cut(s) 155
BspLI GGNNCC 1 cut(s) 88
BsrFI RCCGGY 1 cut(s) 136
BssAI RCCGGY 1 cut(s) 136
BssMI GATC 2 cut(s) 189, 199
BstENI CCTNNNNNAGG 1 cut(s) 81
BstKTI GATC 2 cut(s) 192, 202
BstMBI GATC 2 cut(s) 189, 199
BtsIMutI CAGTG 1 cut(s) 126
Cfr10I RCCGGY 1 cut(s) 136
Cfr13I GGNCC 3 cut(s) 23, 74, 105
CviAII CATG 1 cut(s) 102
CviJI RGCY 3 cut(s) 11, 136, 175
CviKI_1 RGCY 3 cut(s) 11, 136, 175
DpnI GATC 2 cut(s) 191, 201
DpnII GATC 2 cut(s) 189, 199
Eco47I GGWCC 3 cut(s) 23, 74, 105
EcoNI CCTNNNNNAGG 1 cut(s) 81
EcoO109I RGGNCCY 1 cut(s) 74
FaeI CATG 1 cut(s) 105
FaiI YATR 4 cut(s) 43, 66, 103, 149
FatI CATG 1 cut(s) 101
FspBI CTAG 2 cut(s) 36, 95
GsaI CCCAGC 1 cut(s) 11
HapII CCGG 1 cut(s) 137
Hin1II CATG 1 cut(s) 105
HpaII CCGG 1 cut(s) 137
HpyCH4V TGCA 1 cut(s) 41
Hsp92II CATG 1 cut(s) 105
Kzo9I GATC 2 cut(s) 189, 199
LpnPI CCDG 6 cut(s) 21, 25, 39, 90, 128, 150
MaeI CTAG 2 cut(s) 36, 95
MaeIII GTNAC 1 cut(s) 124
MalI GATC 2 cut(s) 191, 201
MboI GATC 2 cut(s) 189, 199
MboII GAAGA 1 cut(s) 199
MluCI AATT 1 cut(s) 54
MspI CCGG 1 cut(s) 137
NdeII GATC 2 cut(s) 189, 199
NlaIII CATG 1 cut(s) 105
NlaIV GGNNCC 1 cut(s) 88
NmuCI GTSAC 1 cut(s) 124
PpuMI RGGWCCY 1 cut(s) 74
Psp5II RGGWCCY 1 cut(s) 74
PspFI CCCAGC 1 cut(s) 7
PspN4I GGNNCC 1 cut(s) 88
PspPI GGNCC 3 cut(s) 23, 74, 105
PspPPI RGGWCCY 1 cut(s) 74
Sau3AI GATC 2 cut(s) 189, 199
Sau96I GGNCC 3 cut(s) 23, 74, 105
SetI ASST 3 cut(s) 79, 110, 177
SinI GGWCC 3 cut(s) 23, 74, 105
Sse9I AATT 1 cut(s) 54
SsiI CCGC 1 cut(s) 155
SspMI CTAG 2 cut(s) 36, 95
TaqI TCGA 1 cut(s) 192
TasI AATT 1 cut(s) 54
TscAI CASTG 1 cut(s) 133
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 4 cut(s) 17, 106, 156, 200
TspGWI ACGGA 1 cut(s) 193
TspRI CASTG 1 cut(s) 133
VpaK11BI GGWCC 3 cut(s) 23, 74, 105
XagI CCTNNNNNAGG 1 cut(s) 81
XapI RAATTY 1 cut(s) 54
XspI CTAG 2 cut(s) 36, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.