Rmu_co8307587.1_g000001

Belongs to the MIP aquaporin (TC 1.A.8) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8307587.1
Physical Location & Seq
Forward (+)
409 .. 681
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8307587.1_g000001.1.cds

Sequence Viewer

Length: 273 bp
atgctcagaccaatatcaggtggatctatgaatccagcaaggacaataggaccagcacttgctagttcatattacaatgggatttggatctacatggtaggaccagtgatcggaacactactaggggcatgggcttacagcttcattcgggtcagtgacaagccggttcaggcaataccacggcgttcactttcacaccagcttcgtcaagtgagcgatgttaatggtgggcaggctgttaccagctgcgaagaccctctagatttagcttga

Protein Analysis

90

Amino Acids

9.66

Weight (kDa)

9.03

Isoelectric Point (pI)

41.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 31, 95
AfiI CCNNNNNNNGG 2 cut(s) 17, 110
AluBI AGCT 4 cut(s) 141, 202, 246, 269
AluI AGCT 4 cut(s) 141, 202, 246, 269
AlwI GGATC 2 cut(s) 31, 95
ApeKI GCWGC 1 cut(s) 246
AspS9I GGNCC 2 cut(s) 50, 101
AvaII GGWCC 2 cut(s) 50, 101
BbsI GAAGAC 1 cut(s) 258
BbvI GCAGC 1 cut(s) 233
BceAI ACGGC 1 cut(s) 197
BfaI CTAG 3 cut(s) 63, 122, 260
BisI GCNGC 1 cut(s) 247
BlsI GCNGC 1 cut(s) 248
Bme18I GGWCC 2 cut(s) 50, 101
BmgT120I GGNCC 2 cut(s) 50, 101
BpiI GAAGAC 1 cut(s) 258
BsaBI GATNNNNATC 1 cut(s) 86
BsaJI CCNNGG 1 cut(s) 179
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 110
Bse118I RCCGGY 1 cut(s) 163
Bse1I ACTGG 1 cut(s) 104
Bse8I GATNNNNATC 1 cut(s) 86
BseDI CCNNGG 1 cut(s) 179
BseJI GATNNNNATC 1 cut(s) 86
BseLI CCNNNNNNNGG 2 cut(s) 17, 110
BseMII CTCAG 1 cut(s) 19
BseNI ACTGG 1 cut(s) 104
BseXI GCAGC 1 cut(s) 233
BsiSI CCGG 1 cut(s) 164
BslI CCNNNNNNNGG 2 cut(s) 17, 110
Bsp143I GATC 3 cut(s) 23, 87, 108
BspCNI CTCAG 1 cut(s) 18
BspPI GGATC 2 cut(s) 31, 95
BsrFI RCCGGY 1 cut(s) 163
BsrI ACTGG 1 cut(s) 104
BssAI RCCGGY 1 cut(s) 163
BssECI CCNNGG 1 cut(s) 179
BssMI GATC 3 cut(s) 23, 87, 108
BstC8I GCNNGC 1 cut(s) 234
BstDEI CTNAG 1 cut(s) 5
BstDSI CCRYGG 1 cut(s) 179
BstKTI GATC 3 cut(s) 26, 90, 111
BstMBI GATC 3 cut(s) 23, 87, 108
BstV1I GCAGC 1 cut(s) 233
BstV2I GAAGAC 1 cut(s) 258
BstX2I RGATCY 2 cut(s) 23, 87
BstYI RGATCY 2 cut(s) 23, 87
BtgI CCRYGG 1 cut(s) 179
BtgZI GCGATG 1 cut(s) 231
BtsIMutI CAGTG 2 cut(s) 111, 160
Cac8I GCNNGC 1 cut(s) 234
Cfr10I RCCGGY 1 cut(s) 163
Cfr13I GGNCC 2 cut(s) 50, 101
CviAII CATG 2 cut(s) 94, 129
CviJI RGCY 7 cut(s) 134, 141, 163, 202, 236, 246, 269
CviKI_1 RGCY 7 cut(s) 134, 141, 163, 202, 236, 246, 269
DdeI CTNAG 1 cut(s) 5
DpnI GATC 3 cut(s) 25, 89, 110
DpnII GATC 3 cut(s) 23, 87, 108
Eco47I GGWCC 2 cut(s) 50, 101
FaeI CATG 2 cut(s) 97, 132
FaiI YATR 4 cut(s) 29, 70, 95, 130
FatI CATG 2 cut(s) 93, 128
Fnu4HI GCNGC 1 cut(s) 247
Fsp4HI GCNGC 1 cut(s) 247
FspBI CTAG 3 cut(s) 63, 122, 260
GluI GCNGC 1 cut(s) 247
HapII CCGG 1 cut(s) 164
Hin1II CATG 2 cut(s) 97, 132
HinfI GANTC 1 cut(s) 31
HpaII CCGG 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 188
Hpy188I TCNGA 2 cut(s) 8, 113
Hpy188III TCNNGA 1 cut(s) 260
Hpy8I GTNNAC 1 cut(s) 188
HpyF3I CTNAG 1 cut(s) 5
Hsp92II CATG 2 cut(s) 97, 132
Kzo9I GATC 3 cut(s) 23, 87, 108
LpnPI CCDG 9 cut(s) 3, 48, 66, 117, 155, 177, 212, 218, 256
Lsp1109I GCAGC 1 cut(s) 233
MaeI CTAG 3 cut(s) 63, 122, 260
MaeIII GTNAC 2 cut(s) 155, 238
MalI GATC 3 cut(s) 25, 89, 110
MboI GATC 3 cut(s) 23, 87, 108
MboII GAAGA 1 cut(s) 263
MflI RGATCY 2 cut(s) 23, 87
MnlI CCTC 1 cut(s) 267
MseI TTAA 1 cut(s) 222
MspA1I CMGCKG 1 cut(s) 246
MspI CCGG 1 cut(s) 164
NdeII GATC 3 cut(s) 23, 87, 108
NlaIII CATG 2 cut(s) 97, 132
NmuCI GTSAC 1 cut(s) 155
PfeI GAWTC 1 cut(s) 31
PkrI GCNGC 1 cut(s) 248
PspPI GGNCC 2 cut(s) 50, 101
PsuI RGATCY 2 cut(s) 23, 87
PvuII CAGCTG 1 cut(s) 246
SaqAI TTAA 1 cut(s) 222
SatI GCNGC 1 cut(s) 247
Sau3AI GATC 3 cut(s) 23, 87, 108
Sau96I GGNCC 2 cut(s) 50, 101
SetI ASST 5 cut(s) 22, 143, 204, 248, 271
SinI GGWCC 2 cut(s) 50, 101
SspMI CTAG 3 cut(s) 63, 122, 260
TfiI GAWTC 1 cut(s) 31
Tru1I TTAA 1 cut(s) 222
Tru9I TTAA 1 cut(s) 222
TscAI CASTG 2 cut(s) 111, 160
TseFI GTSAC 1 cut(s) 155
TseI GCWGC 1 cut(s) 246
Tsp45I GTSAC 1 cut(s) 155
TspDTI ATGAA 3 cut(s) 44, 57, 133
TspRI CASTG 2 cut(s) 111, 160
VpaK11BI GGWCC 2 cut(s) 50, 101
XbaI TCTAGA 1 cut(s) 259
XspI CTAG 3 cut(s) 63, 122, 260
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.