pycom12g00360

Protein of unknown function (DUF2470)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
381521 .. 385676
4156 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 291 bp
ATGCTCCGATTTAGACTTAGAGTACACCAGAATATCGTCAATGAAGACAATGACAAACCTATCCAAATAGGTTGGAATACTCGGTTCATCAAACTGGCACTTGCTAAATTTAGTATCACTGTTGTGAAGCCTTGGCAGACCAACCTATTCTCTATCTTAAATGGCCATAATACCCTTCACTCCCCTCACATCTTACAATTTCGCCCCTCCTCCACCTTCTTCTCCTCCCCAACAACTCCTCCTCGTTTATCCATGGCTACCGCCGCCGCTCAGTCAGCTACTCAGGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.92

Weight (kDa)

11.38

Isoelectric Point (pI)

52.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 269
AciI CCGC 3 cut(s) 261, 264, 267
AcoI YGGCCR 1 cut(s) 163
AcsI RAATTY 1 cut(s) 107
AfaI GTAC 1 cut(s) 24
AleI CACNNNNGTG 1 cut(s) 122
AluBI AGCT 1 cut(s) 278
AluI AGCT 1 cut(s) 278
AoxI GGCC 1 cut(s) 163
ApoI RAATTY 1 cut(s) 107
BalI TGGCCA 1 cut(s) 165
BbsI GAAGAC 1 cut(s) 51
BisI GCNGC 2 cut(s) 264, 267
BlsI GCNGC 2 cut(s) 265, 268
BpiI GAAGAC 1 cut(s) 51
BsaJI CCNNGG 2 cut(s) 131, 252
BsaXI ACNNNNNCTCC 2 cut(s) 223, 253
Bse1I ACTGG 1 cut(s) 99
BseDI CCNNGG 2 cut(s) 131, 252
BseMII CTCAG 1 cut(s) 284
BseNI ACTGG 1 cut(s) 99
BseRI GAGGAG 4 cut(s) 199, 214, 228, 231
BshFI GGCC 1 cut(s) 165
BsnI GGCC 1 cut(s) 165
Bsp19I CCATGG 1 cut(s) 252
BspACI CCGC 3 cut(s) 261, 264, 267
BspANI GGCC 1 cut(s) 165
BspCNI CTCAG 1 cut(s) 283
BsrBI CCGCTC 1 cut(s) 269
BsrI ACTGG 1 cut(s) 99
BssECI CCNNGG 2 cut(s) 131, 252
BssT1I CCWWGG 2 cut(s) 131, 252
Bst4CI ACNGT 1 cut(s) 121
BstDEI CTNAG 3 cut(s) 17, 270, 282
BstDSI CCRYGG 1 cut(s) 252
BstMWI GCNNNNNNNGC 2 cut(s) 263, 275
BstV2I GAAGAC 1 cut(s) 51
BsuRI GGCC 1 cut(s) 165
BtgI CCRYGG 1 cut(s) 252
BtsIMutI CAGTG 1 cut(s) 117
Csp6I GTAC 1 cut(s) 23
CviAII CATG 1 cut(s) 253
CviJI RGCY 4 cut(s) 130, 165, 257, 278
CviKI_1 RGCY 4 cut(s) 130, 165, 257, 278
CviQI GTAC 1 cut(s) 23
DdeI CTNAG 3 cut(s) 17, 270, 282
EaeI YGGCCR 1 cut(s) 163
Eco130I CCWWGG 2 cut(s) 131, 252
EcoT14I CCWWGG 2 cut(s) 131, 252
ErhI CCWWGG 2 cut(s) 131, 252
FaeI CATG 1 cut(s) 256
FaiI YATR 2 cut(s) 168, 254
FatI CATG 1 cut(s) 252
Fnu4HI GCNGC 2 cut(s) 264, 267
Fsp4HI GCNGC 2 cut(s) 264, 267
GluI GCNGC 2 cut(s) 264, 267
HaeIII GGCC 1 cut(s) 165
Hin1II CATG 1 cut(s) 256
Hpy166II GTNNAC 1 cut(s) 25
Hpy188I TCNGA 1 cut(s) 8
Hpy188III TCNNGA 1 cut(s) 284
Hpy8I GTNNAC 1 cut(s) 25
HpyAV CCTTC 2 cut(s) 185, 226
HpyCH4III ACNGT 1 cut(s) 121
HpyF10VI GCNNNNNNNGC 2 cut(s) 263, 275
HpyF3I CTNAG 3 cut(s) 17, 270, 282
Hsp92II CATG 1 cut(s) 256
LmnI GCTCC 1 cut(s) 9
LpnPI CCDG 3 cut(s) 41, 80, 269
MbiI CCGCTC 1 cut(s) 269
MboII GAAGA 2 cut(s) 56, 211
MlsI TGGCCA 1 cut(s) 165
MluCI AATT 2 cut(s) 107, 197
MluNI TGGCCA 1 cut(s) 165
MmeI TCCRAC 1 cut(s) 53
MnlI CCTC 6 cut(s) 195, 217, 220, 235, 249, 252
Mox20I TGGCCA 1 cut(s) 165
MscI TGGCCA 1 cut(s) 165
MseI TTAA 1 cut(s) 158
MslI CAYNNNNRTG 1 cut(s) 122
Msp20I TGGCCA 1 cut(s) 165
MwoI GCNNNNNNNGC 2 cut(s) 263, 275
NcoI CCATGG 1 cut(s) 252
NlaIII CATG 1 cut(s) 256
OliI CACNNNNGTG 1 cut(s) 122
PkrI GCNGC 2 cut(s) 265, 268
RsaI GTAC 1 cut(s) 24
RsaNI GTAC 1 cut(s) 23
RseI CAYNNNNRTG 1 cut(s) 122
SaqAI TTAA 1 cut(s) 158
SatI GCNGC 2 cut(s) 264, 267
SetI ASST 5 cut(s) 61, 73, 147, 218, 280
SgeI CNNG 7 cut(s) 40, 93, 107, 113, 144, 255, 265
SmiMI CAYNNNNRTG 1 cut(s) 122
Sse9I AATT 2 cut(s) 107, 197
SsiI CCGC 3 cut(s) 261, 264, 267
StyI CCWWGG 2 cut(s) 131, 252
TaaI ACNGT 1 cut(s) 121
TasI AATT 2 cut(s) 107, 197
TatI WGTACW 1 cut(s) 22
TauI GCSGC 2 cut(s) 266, 269
Tru1I TTAA 1 cut(s) 158
Tru9I TTAA 1 cut(s) 158
TscAI CASTG 1 cut(s) 124
TspDTI ATGAA 2 cut(s) 57, 76
TspRI CASTG 1 cut(s) 124
XapI RAATTY 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.