RchiOBHm_Chr5g0029821

leucine-rich repeat receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
23612011 .. 23612677
667 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 249 bp
ATGGATTTCAATTATTTCTCTGGAGGTCTTCCTTGGGAACTTGGATTTTTGCCGAGCATAGAAACACTTCGGATTATTGACAATTCCTTTTCTGGGAAGATACCAAATTATATTCAAAACTGGACAAATCTTCACAAACTAGGGATTCAGGCTAGTGGTTTGACCGGACCAATTCCTTCTGGAATTTCTCTCTTGACAAGTTTAACTGACCTGTTAGTTCGGCTCTTATGTCTTTATAAATTCAAATAG

Protein Analysis

82

Amino Acids

9.16

Weight (kDa)

7.89

Isoelectric Point (pI)

18.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 237
AcsI RAATTY 2 cut(s) 183, 239
AfiI CCNNNNNNNGG 1 cut(s) 93
AgsI TTSAA 3 cut(s) 10, 116, 244
ApoI RAATTY 2 cut(s) 183, 239
Asp700I GAANNNNTTC 1 cut(s) 66
AspS9I GGNCC 1 cut(s) 167
AvaII GGWCC 1 cut(s) 167
BbsI GAAGAC 1 cut(s) 20
BfaI CTAG 2 cut(s) 140, 153
Bme18I GGWCC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 167
BpiI GAAGAC 1 cut(s) 20
BpmI CTGGAG 1 cut(s) 42
BsaJI CCNNGG 1 cut(s) 32
BsaWI WCCGGW 1 cut(s) 164
Bsc4I CCNNNNNNNGG 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 125
BseDI CCNNGG 1 cut(s) 32
BseLI CCNNNNNNNGG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 125
BsiSI CCGG 1 cut(s) 165
BslI CCNNNNNNNGG 1 cut(s) 93
BsrI ACTGG 1 cut(s) 125
BssECI CCNNGG 1 cut(s) 32
BssT1I CCWWGG 1 cut(s) 32
BstV2I GAAGAC 1 cut(s) 20
Cfr13I GGNCC 1 cut(s) 167
CviJI RGCY 2 cut(s) 152, 223
CviKI_1 RGCY 2 cut(s) 152, 223
Eco130I CCWWGG 1 cut(s) 32
Eco47I GGWCC 1 cut(s) 167
EcoT14I CCWWGG 1 cut(s) 32
ErhI CCWWGG 1 cut(s) 32
FaiI YATR 4 cut(s) 59, 111, 229, 237
FspBI CTAG 2 cut(s) 140, 153
GsuI CTGGAG 1 cut(s) 42
HapII CCGG 1 cut(s) 165
HinfI GANTC 1 cut(s) 145
HpaII CCGG 1 cut(s) 165
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 3 cut(s) 21, 180, 193
HpyAV CCTTC 1 cut(s) 186
LpnPI CCDG 7 cut(s) 6, 78, 106, 134, 165, 178, 224
MaeI CTAG 2 cut(s) 140, 153
MboII GAAGA 3 cut(s) 20, 109, 122
MluCI AATT 6 cut(s) 10, 82, 106, 171, 183, 239
MnlI CCTC 1 cut(s) 17
MroXI GAANNNNTTC 1 cut(s) 66
MseI TTAA 1 cut(s) 203
MspI CCGG 1 cut(s) 165
NmeAIII GCCGAG 1 cut(s) 78
PdmI GAANNNNTTC 1 cut(s) 66
PfeI GAWTC 1 cut(s) 145
PsiI TTATAA 1 cut(s) 237
PspPI GGNCC 1 cut(s) 167
SaqAI TTAA 1 cut(s) 203
Sau96I GGNCC 1 cut(s) 167
SetI ASST 2 cut(s) 28, 213
SinI GGWCC 1 cut(s) 167
Sse9I AATT 6 cut(s) 10, 82, 106, 171, 183, 239
SspMI CTAG 2 cut(s) 140, 153
StyI CCWWGG 1 cut(s) 32
TasI AATT 6 cut(s) 10, 82, 106, 171, 183, 239
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 1 cut(s) 203
Tru9I TTAA 1 cut(s) 203
VpaK11BI GGWCC 1 cut(s) 167
XapI RAATTY 2 cut(s) 183, 239
XmnI GAANNNNTTC 1 cut(s) 66
XspI CTAG 2 cut(s) 140, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.