RchiOBHm_Chr4g0419351

receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
44783612 .. 44784104
493 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38926

Sequence Viewer

Length: 180 bp
ATGCCCAGCCCTAATATCCAGGACAAACTGGTATCGAAGGATTTTGATATTACAAAGGAAGCATTAGGGGTTGATAAGGACGTGATCAAGGTATTTAAAGCAGTTTTTAATGTTAAGACTTTACTGATCCGCTTTCAGTGGGCTGGGAAAGGGACAACTAATGTTCCACTAGGAGGATAA

Protein Analysis

59

Amino Acids

6.49

Weight (kDa)

9.52

Isoelectric Point (pI)

22.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Malectin PF11721 6 - 57 3.2e-06 Malectin domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 130
AclWI GGATC 1 cut(s) 121
AfiI CCNNNNNNNGG 1 cut(s) 173
AjiI CACGTC 1 cut(s) 82
AjnI CCWGG 1 cut(s) 18
AlwI GGATC 1 cut(s) 121
BciT130I CCWGG 1 cut(s) 20
BclI TGATCA 1 cut(s) 84
BfaI CTAG 1 cut(s) 170
Bme1390I CCNGG 1 cut(s) 20
BmgBI CACGTC 1 cut(s) 82
BmrFI CCNGG 1 cut(s) 20
Bsc4I CCNNNNNNNGG 1 cut(s) 173
Bse1I ACTGG 1 cut(s) 33
BseBI CCWGG 1 cut(s) 20
BseLI CCNNNNNNNGG 1 cut(s) 173
BseNI ACTGG 1 cut(s) 33
BseYI CCCAGC 2 cut(s) 5, 143
BslFI GGGAC 1 cut(s) 166
BslI CCNNNNNNNGG 1 cut(s) 173
BsmFI GGGAC 1 cut(s) 166
Bsp143I GATC 2 cut(s) 84, 126
BspACI CCGC 1 cut(s) 130
BspPI GGATC 1 cut(s) 121
BsrI ACTGG 1 cut(s) 33
BssMI GATC 2 cut(s) 84, 126
Bst2UI CCWGG 1 cut(s) 20
BstKTI GATC 2 cut(s) 87, 129
BstMBI GATC 2 cut(s) 84, 126
BstNI CCWGG 1 cut(s) 20
BstSCI CCNGG 1 cut(s) 18
BtrI CACGTC 1 cut(s) 82
BtsIMutI CAGTG 1 cut(s) 143
CviJI RGCY 2 cut(s) 9, 143
CviKI_1 RGCY 2 cut(s) 9, 143
DpnI GATC 2 cut(s) 86, 128
DpnII GATC 2 cut(s) 84, 126
DraI TTTAAA 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 18
FaqI GGGAC 1 cut(s) 166
FbaI TGATCA 1 cut(s) 84
FspBI CTAG 1 cut(s) 170
GsaI CCCAGC 2 cut(s) 9, 147
HpyAV CCTTC 1 cut(s) 31
HpyCH4IV ACGT 1 cut(s) 81
HpySE526I ACGT 1 cut(s) 81
Ksp22I TGATCA 1 cut(s) 84
Kzo9I GATC 2 cut(s) 84, 126
LpnPI CCDG 5 cut(s) 5, 14, 19, 32, 129
MaeI CTAG 1 cut(s) 170
MaeII ACGT 1 cut(s) 81
MalI GATC 2 cut(s) 86, 128
MboI GATC 2 cut(s) 84, 126
MnlI CCTC 1 cut(s) 167
MseI TTAA 3 cut(s) 96, 108, 114
MspR9I CCNGG 1 cut(s) 20
MvaI CCWGG 1 cut(s) 20
NdeII GATC 2 cut(s) 84, 126
PfoI TCCNGGA 1 cut(s) 18
Psp6I CCWGG 1 cut(s) 18
PspFI CCCAGC 2 cut(s) 5, 143
PspGI CCWGG 1 cut(s) 18
SaqAI TTAA 3 cut(s) 96, 108, 114
Sau3AI GATC 2 cut(s) 84, 126
ScrFI CCNGG 1 cut(s) 20
SetI ASST 2 cut(s) 84, 93
SgeI CNNG 7 cut(s) 18, 31, 32, 41, 94, 100, 156
SsiI CCGC 1 cut(s) 130
SspMI CTAG 1 cut(s) 170
StyD4I CCNGG 1 cut(s) 18
TaiI ACGT 1 cut(s) 84
TaqI TCGA 1 cut(s) 35
Tru1I TTAA 3 cut(s) 96, 108, 114
Tru9I TTAA 3 cut(s) 96, 108, 114
TscAI CASTG 1 cut(s) 143
TspRI CASTG 1 cut(s) 143
XspI CTAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.