Rroxscaffold_1G00064520

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
86385672 .. 86387877
2206 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00064520.1

Sequence Viewer

Length: 234 bp
ATGGCTGGTCTAACAGAGAAGCCACCAGAGGAATCTGAGAGCACAACAGAATGTGAATGCCACTTCGAGAACGACACAGTTTGTCATGTCGTCAGATTATCTGTTCTTGTTAATCGCTTATCAGGGAAAATTCCAAAGGAGTTGGGAAATATAACAACTCTCAAGTACCTGGATCTTAAGTTAGTGGGTGAACTTCCATCCACAACAGGCACCGAGCGACTGAAATATGTGTGA

Protein Analysis

77

Amino Acids

8.56

Weight (kDa)

5.3

Isoelectric Point (pI)

49.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 209
AclWI GGATC 1 cut(s) 180
AcsI RAATTY 1 cut(s) 129
AfaI GTAC 1 cut(s) 167
AflII CTTAAG 1 cut(s) 176
AjnI CCWGG 1 cut(s) 168
Alw21I GWGCWC 1 cut(s) 44
AlwI GGATC 1 cut(s) 180
ApoI RAATTY 1 cut(s) 129
AsuHPI GGTGA 1 cut(s) 200
BanI GGYRCC 1 cut(s) 209
Bbv12I GWGCWC 1 cut(s) 44
BccI CCATC 1 cut(s) 205
BciT130I CCWGG 1 cut(s) 170
BfrI CTTAAG 1 cut(s) 176
Bme1390I CCNGG 1 cut(s) 170
BmiI GGNNCC 1 cut(s) 211
BmrFI CCNGG 1 cut(s) 170
BpuEI CTTGAG 1 cut(s) 146
BseBI CCWGG 1 cut(s) 170
BseGI GGATG 1 cut(s) 197
BseMII CTCAG 1 cut(s) 27
BshNI GGYRCC 1 cut(s) 209
BsiHKAI GWGCWC 1 cut(s) 44
BsmI GAATGC 1 cut(s) 62
Bsp1286I GDGCHC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 172
BspCNI CTCAG 1 cut(s) 28
BspLI GGNNCC 1 cut(s) 211
BspPI GGATC 1 cut(s) 180
BspT107I GGYRCC 1 cut(s) 209
BspTI CTTAAG 1 cut(s) 176
BssMI GATC 1 cut(s) 172
Bst2UI CCWGG 1 cut(s) 170
Bst4CI ACNGT 1 cut(s) 79
BstAFI CTTAAG 1 cut(s) 176
BstDEI CTNAG 1 cut(s) 36
BstF5I GGATG 1 cut(s) 197
BstKTI GATC 1 cut(s) 175
BstMBI GATC 1 cut(s) 172
BstNI CCWGG 1 cut(s) 170
BstSCI CCNGG 1 cut(s) 168
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
BtsCI GGATG 1 cut(s) 197
Csp6I GTAC 1 cut(s) 166
CviAII CATG 1 cut(s) 86
CviJI RGCY 2 cut(s) 5, 22
CviKI_1 RGCY 2 cut(s) 5, 22
CviQI GTAC 1 cut(s) 166
DdeI CTNAG 1 cut(s) 36
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
EcoRII CCWGG 1 cut(s) 168
FaeI CATG 1 cut(s) 89
FaiI YATR 3 cut(s) 87, 152, 228
FatI CATG 1 cut(s) 85
FokI GGATG 1 cut(s) 184
Hin1II CATG 1 cut(s) 89
HinfI GANTC 1 cut(s) 32
HphI GGTGA 1 cut(s) 200
Hpy166II GTNNAC 1 cut(s) 191
Hpy188I TCNGA 2 cut(s) 37, 95
Hpy188III TCNNGA 1 cut(s) 67
Hpy8I GTNNAC 1 cut(s) 191
HpyCH4III ACNGT 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 36
Hsp92II CATG 1 cut(s) 89
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 5 cut(s) 39, 108, 155, 182, 192
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MflI RGATCY 1 cut(s) 172
MhlI GDGCHC 1 cut(s) 44
MluCI AATT 1 cut(s) 129
MnlI CCTC 1 cut(s) 22
MseI TTAA 2 cut(s) 111, 177
MspCI CTTAAG 1 cut(s) 176
MspR9I CCNGG 1 cut(s) 170
Mva1269I GAATGC 1 cut(s) 62
MvaI CCWGG 1 cut(s) 170
NdeII GATC 1 cut(s) 172
NlaIII CATG 1 cut(s) 89
NlaIV GGNNCC 1 cut(s) 211
PctI GAATGC 1 cut(s) 62
PfeI GAWTC 1 cut(s) 32
Psp6I CCWGG 1 cut(s) 168
PspGI CCWGG 1 cut(s) 168
PspN4I GGNNCC 1 cut(s) 211
PsuI RGATCY 1 cut(s) 172
RsaI GTAC 1 cut(s) 167
RsaNI GTAC 1 cut(s) 166
SaqAI TTAA 2 cut(s) 111, 177
Sau3AI GATC 1 cut(s) 172
ScrFI CCNGG 1 cut(s) 170
SduI GDGCHC 1 cut(s) 44
SetI ASST 1 cut(s) 171
SmlI CTYRAG 2 cut(s) 161, 176
SmoI CTYRAG 2 cut(s) 161, 176
Sse9I AATT 1 cut(s) 129
StyD4I CCNGG 1 cut(s) 168
TaaI ACNGT 1 cut(s) 79
TaqI TCGA 1 cut(s) 66
TasI AATT 1 cut(s) 129
TfiI GAWTC 1 cut(s) 32
Tru1I TTAA 2 cut(s) 111, 177
Tru9I TTAA 2 cut(s) 111, 177
Vha464I CTTAAG 1 cut(s) 176
XapI RAATTY 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.