RchiOBHm_Chr2g0103031

The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
14686010 .. 14687337
1328 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 255 bp
ATGAAACCAAAGACTTGTGCCAGCCTTGTCTCTGCTATTCTTTATGAAAAAAGAAAAGAAAACAAAAAAAGGGAACTAGCGAAAATTTTTCATGTTGCTGGCTCTGGGTCAGAGCCCCTTTATGGTGCTTGTGAGGCGATGTTCAAGCCTGATATGGAGCAAGAGGACTTGTTTGAGCCCATATCTGAAGCATTGCTATCATCAGTAGATCGTGATTGTCTGAATGAGTGGGGATGCCATTTCTATGTGTTGTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.54

Weight (kDa)

5.33

Isoelectric Point (pI)

41.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Proteasome PF00227 31 - 83 2.4e-09 Proteasome subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 84
AcuI CTGAAG 1 cut(s) 207
AfiI CCNNNNNNNGG 1 cut(s) 122
AgsI TTSAA 1 cut(s) 145
Alw26I GTCTC 1 cut(s) 34
ApoI RAATTY 1 cut(s) 84
BanII GRGCYC 2 cut(s) 117, 180
BcoDI GTCTC 1 cut(s) 34
BfaI CTAG 1 cut(s) 77
BmsI GCATC 1 cut(s) 224
Bsc4I CCNNNNNNNGG 1 cut(s) 122
Bse3DI GCAATG 1 cut(s) 191
BseGI GGATG 1 cut(s) 239
BseLI CCNNNNNNNGG 1 cut(s) 122
BseMI GCAATG 1 cut(s) 191
BslI CCNNNNNNNGG 1 cut(s) 122
BsmAI GTCTC 1 cut(s) 34
Bsp1286I GDGCHC 2 cut(s) 117, 180
Bsp143I GATC 1 cut(s) 208
BsrDI GCAATG 1 cut(s) 191
BssMI GATC 1 cut(s) 208
BstC8I GCNNGC 2 cut(s) 22, 100
BstF5I GGATG 1 cut(s) 239
BstKTI GATC 1 cut(s) 211
BstMAI GTCTC 1 cut(s) 34
BstMBI GATC 1 cut(s) 208
BstMWI GCNNNNNNNGC 1 cut(s) 134
BtgZI GCGATG 1 cut(s) 152
BtsCI GGATG 1 cut(s) 239
Cac8I GCNNGC 2 cut(s) 22, 100
CviAII CATG 1 cut(s) 92
CviJI RGCY 5 cut(s) 24, 102, 115, 148, 178
CviKI_1 RGCY 5 cut(s) 24, 102, 115, 148, 178
DpnI GATC 1 cut(s) 210
DpnII GATC 1 cut(s) 208
Eco24I GRGCYC 2 cut(s) 117, 180
Eco57I CTGAAG 1 cut(s) 207
EcoT38I GRGCYC 2 cut(s) 117, 180
FaeI CATG 1 cut(s) 95
FaiI YATR 6 cut(s) 45, 93, 123, 155, 182, 246
FatI CATG 1 cut(s) 91
FokI GGATG 1 cut(s) 246
FriOI GRGCYC 2 cut(s) 117, 180
FspBI CTAG 1 cut(s) 77
Hin1II CATG 1 cut(s) 95
Hpy188I TCNGA 3 cut(s) 112, 187, 222
Hpy188III TCNNGA 1 cut(s) 212
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
Hsp92II CATG 1 cut(s) 95
Kzo9I GATC 1 cut(s) 208
LmnI GCTCC 1 cut(s) 157
LpnPI CCDG 4 cut(s) 34, 84, 90, 162
LweI GCATC 1 cut(s) 224
MaeI CTAG 1 cut(s) 77
MalI GATC 1 cut(s) 210
MboI GATC 1 cut(s) 208
MhlI GDGCHC 2 cut(s) 117, 180
MluCI AATT 1 cut(s) 84
MnlI CCTC 2 cut(s) 127, 157
MslI CAYNNNNRTG 1 cut(s) 243
MwoI GCNNNNNNNGC 1 cut(s) 134
NdeII GATC 1 cut(s) 208
NlaIII CATG 1 cut(s) 95
RseI CAYNNNNRTG 1 cut(s) 243
Sau3AI GATC 1 cut(s) 208
SduI GDGCHC 2 cut(s) 117, 180
SfaNI GCATC 1 cut(s) 224
SmiMI CAYNNNNRTG 1 cut(s) 243
Sse9I AATT 1 cut(s) 84
SspMI CTAG 1 cut(s) 77
TasI AATT 1 cut(s) 84
TspDTI ATGAA 3 cut(s) 17, 60, 80
XapI RAATTY 1 cut(s) 84
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.