Rmu_sc0000388.1_g000016

The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000388.1
Physical Location & Seq
Forward (+)
91319 .. 92311
993 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000388.1_g000016.1.cds

Sequence Viewer

Length: 216 bp
atgatcaacacaagcaattcatgcgcactatggattcaattggagctagcaaaggaactagcgaaaatttttcatgttgctggctctgggtcagagcccctttatggtcctgatatggagcaagaggactcgtttgagcccatatctgaagcattgctatcatcagtagatcgtgattgtctgagtgagtggggatgccatttctatgtgttgtaa

Protein Analysis

71

Amino Acids

7.92

Weight (kDa)

4.19

Isoelectric Point (pI)

43.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 25
AcsI RAATTY 1 cut(s) 66
AcuI CTGAAG 1 cut(s) 168
AfiI CCNNNNNNNGG 1 cut(s) 104
AgsI TTSAA 1 cut(s) 38
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
ApoI RAATTY 1 cut(s) 66
AspLEI GCGC 1 cut(s) 26
AspS9I GGNCC 1 cut(s) 107
AsuNHI GCTAGC 1 cut(s) 46
AvaII GGWCC 1 cut(s) 107
BanII GRGCYC 2 cut(s) 99, 141
BclI TGATCA 1 cut(s) 3
BfaI CTAG 2 cut(s) 47, 59
Bme18I GGWCC 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 107
BmsI GCATC 1 cut(s) 185
BmtI GCTAGC 1 cut(s) 50
Bsc4I CCNNNNNNNGG 1 cut(s) 104
Bse3DI GCAATG 1 cut(s) 152
BseGI GGATG 1 cut(s) 200
BseLI CCNNNNNNNGG 1 cut(s) 104
BseMI GCAATG 1 cut(s) 152
BseMII CTCAG 1 cut(s) 173
BslI CCNNNNNNNGG 1 cut(s) 104
Bsp1286I GDGCHC 2 cut(s) 99, 141
Bsp143I GATC 2 cut(s) 3, 169
BspCNI CTCAG 1 cut(s) 174
BspOI GCTAGC 1 cut(s) 50
BsrDI GCAATG 1 cut(s) 152
BssMI GATC 2 cut(s) 3, 169
BstAPI GCANNNNNTGC 1 cut(s) 21
BstC8I GCNNGC 2 cut(s) 48, 82
BstDEI CTNAG 1 cut(s) 182
BstF5I GGATG 1 cut(s) 200
BstHHI GCGC 1 cut(s) 26
BstKTI GATC 2 cut(s) 6, 172
BstMBI GATC 2 cut(s) 3, 169
BstMWI GCNNNNNNNGC 1 cut(s) 21
BtsCI GGATG 1 cut(s) 200
Cac8I GCNNGC 2 cut(s) 48, 82
CfoI GCGC 1 cut(s) 26
Cfr13I GGNCC 1 cut(s) 107
CviAII CATG 2 cut(s) 21, 74
CviJI RGCY 4 cut(s) 46, 84, 97, 139
CviKI_1 RGCY 4 cut(s) 46, 84, 97, 139
DdeI CTNAG 1 cut(s) 182
DpnI GATC 2 cut(s) 5, 171
DpnII GATC 2 cut(s) 3, 169
Eco24I GRGCYC 2 cut(s) 99, 141
Eco47I GGWCC 1 cut(s) 107
Eco57I CTGAAG 1 cut(s) 168
EcoT38I GRGCYC 2 cut(s) 99, 141
FaeI CATG 2 cut(s) 24, 77
FaiI YATR 7 cut(s) 22, 31, 75, 105, 116, 143, 207
FatI CATG 2 cut(s) 20, 73
FbaI TGATCA 1 cut(s) 3
FokI GGATG 1 cut(s) 207
FriOI GRGCYC 2 cut(s) 99, 141
FspAI RTGCGCAY 1 cut(s) 25
FspBI CTAG 2 cut(s) 47, 59
FspI TGCGCA 1 cut(s) 25
GlaI GCGC 1 cut(s) 25
HhaI GCGC 1 cut(s) 26
Hin1II CATG 2 cut(s) 24, 77
Hin6I GCGC 1 cut(s) 24
HinP1I GCGC 1 cut(s) 24
HinfI GANTC 2 cut(s) 34, 128
Hpy188I TCNGA 3 cut(s) 94, 148, 183
Hpy188III TCNNGA 2 cut(s) 110, 173
HpyF10VI GCNNNNNNNGC 1 cut(s) 21
HpyF3I CTNAG 1 cut(s) 182
Hsp92II CATG 2 cut(s) 24, 77
HspAI GCGC 1 cut(s) 24
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 169
LmnI GCTCC 2 cut(s) 43, 118
LpnPI CCDG 3 cut(s) 66, 72, 123
LweI GCATC 1 cut(s) 185
MaeI CTAG 2 cut(s) 47, 59
MalI GATC 2 cut(s) 5, 171
MboI GATC 2 cut(s) 3, 169
MfeI CAATTG 1 cut(s) 38
MhlI GDGCHC 2 cut(s) 99, 141
MluCI AATT 3 cut(s) 16, 38, 66
MlyI GAGTC 1 cut(s) 122
MnlI CCTC 1 cut(s) 118
MslI CAYNNNNRTG 1 cut(s) 204
MunI CAATTG 1 cut(s) 38
MwoI GCNNNNNNNGC 1 cut(s) 21
NdeII GATC 2 cut(s) 3, 169
NheI GCTAGC 1 cut(s) 46
NlaIII CATG 2 cut(s) 24, 77
NsbI TGCGCA 1 cut(s) 25
PfeI GAWTC 1 cut(s) 34
PleI GAGTC 1 cut(s) 122
PpsI GAGTC 1 cut(s) 122
PspPI GGNCC 1 cut(s) 107
RseI CAYNNNNRTG 1 cut(s) 204
Sau3AI GATC 2 cut(s) 3, 169
Sau96I GGNCC 1 cut(s) 107
SchI GAGTC 1 cut(s) 122
SduI GDGCHC 2 cut(s) 99, 141
SetI ASST 1 cut(s) 48
SfaNI GCATC 1 cut(s) 185
SinI GGWCC 1 cut(s) 107
SmiMI CAYNNNNRTG 1 cut(s) 204
Sse9I AATT 3 cut(s) 16, 38, 66
SspMI CTAG 2 cut(s) 47, 59
TasI AATT 3 cut(s) 16, 38, 66
TfiI GAWTC 1 cut(s) 34
TspDTI ATGAA 2 cut(s) 9, 62
VpaK11BI GGWCC 1 cut(s) 107
XapI RAATTY 1 cut(s) 66
XspI CTAG 2 cut(s) 47, 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.