Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0022551.1

Orthogroup ID

OG0003233

Physical Location & Seq

Genomic Coordinates Forward (+)

186 .. 2275

Gene Structure 2090 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0022551.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 687 bp

atggctggtgatactgctgtaaggtcattgctagaaaagatggctgaatgtgctagcaatgcttacctgggtatattagagaggtgggtctatgaaggagtcatcgatgatccttatggtgaatttttcattgcggagaacaaatctctgcaaaaggaaagcctcactcaagattatgatgccaagtattggaggcaacgttacagccttaaggatggaattcctagctttcttgcaaatattgctggaacaattttgatcaccggaaagtatctaaatgtcatgagagaatgcgggcaccatgttcaggtccctgtatctgaaaattcaaaattgatgagctttggatcaaatcatcgttatatcgaatgtataaaatctgcttatgactttgcaagcagcgagctcttaaatcttatcaaagaaaagtatgatctgatgggaaagctacgatctataaagcactatcttcttcttgatcagggtgactttttagttcattttatggatattgctcgggatgagcttatgaaaaagcttgacgacatttctgtggagaaactgcaatctctactagaccttgctttgcgaactacagcagctgcagcagatccctgccatgaggacttaacatgttgtgtggtaaacagctcgaaagttttgcttctatgtgaaaagcatggataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0000226 GO:0000278 GO:0000280 GO:0000923 GO:0000930 GO:0003674 GO:0005198 GO:0005200 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0005813 GO:0005815 GO:0005856 GO:0006996 GO:0007010 GO:0007017 GO:0007020 GO:0007049 GO:0007051 GO:0007052 GO:0007098 GO:0008092 GO:0008150 GO:0008275 GO:0009987 GO:0015630 GO:0015631 GO:0016043 GO:0022402 GO:0022414 GO:0022607 GO:0031023 GO:0031109 GO:0031122 GO:0031974 GO:0031981 GO:0032153 GO:0032155 GO:0032991 GO:0034622 GO:0043015 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043933 GO:0044085 GO:0044422 GO:0044424 GO:0044428 GO:0044430 GO:0044444 GO:0044446 GO:0044450 GO:0044464 GO:0046785 GO:0048285 GO:0051225 GO:0051258 GO:0051298 GO:0051321 GO:0051415 GO:0051418 GO:0065003 GO:0070013 GO:0070925 GO:0071840 GO:0090307 GO:0097435 GO:0140014 GO:1902850 GO:1903047

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Spc97_Spc98

Protein Analysis

228

Amino Acids

25.83

Weight (kDa)

5.52

Isoelectric Point (pI)

42.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003233)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G21720 AT1G77440 AT1G77440
fragaria_vesca	FvH4_2g27460
malus_domestica	MD00G1028400.v1.1 MD15G1344700.v1.1
prunus_persica	Prupe.1G492900_v2.0.a1
pyrus_communis	pycom08g13680 pycom15g30930
rosa_chinensis	RchiOBHm_Chr2g0103031 RchiOBHm_Chr2g0140351 RchiOBHm_Chr4g0425031 RchiOBHm_Chr5g0069521 RchiOBHm_Chr6g0296301
rosa_laevigata	RLG00000003407 RLG00000011708 RLG00000019374
rosa_multiflora	Rmu_co8088830.1_g000001 Rmu_sc0000388.1_g000016 Rmu_sc0004708.1_g000006 Rmu_sc0022551.1_g000001
rosa_roxburghii	Rroxscaffold_2G00139980 Rroxscaffold_7G00171650 Rroxscaffold_7G00178420
rosa_rugosa	Rorug02G0111500 Rorug04G0057000 Rorug05G0263600 Rorug06G0260800
rosa_samantha	Rh1BG051400 Rh2CG166500 Rh6BG194900 Rh6BG380500 Rh6DG172500 Rh7DG016200
rosa_wichuraiana	Rw2G012490 Rw4G002730 Rw6G032480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	297
AccB7I	CCANNNNNTGG	1 cut(s)	189
AciI	CCGC	2 cut(s)	134, 294
AclI	AACGTT	1 cut(s)	199
AclWI	GGATC	3 cut(s)	104, 355, 605
AcsI	RAATTY	3 cut(s)	122, 219, 325
AfiI	CCNNNNNNNGG	2 cut(s)	189, 307
AflII	CTTAAG	1 cut(s)	209
AflIII	ACRYGT	1 cut(s)	632
AgsI	TTSAA	1 cut(s)	330
AjnI	CCWGG	1 cut(s)	66
AluBI	AGCT	8 cut(s)	228, 342, 406, 448, 526, 538, 602, 651
AluI	AGCT	8 cut(s)	228, 342, 406, 448, 526, 538, 602, 651
Alw21I	GWGCWC	1 cut(s)	408
AlwI	GGATC	3 cut(s)	104, 355, 605
AlwNI	CAGNNNCTG	1 cut(s)	602
Ama87I	CYCGRG	1 cut(s)	516
ApeKI	GCWGC	4 cut(s)	399, 599, 602, 605
ApoI	RAATTY	3 cut(s)	122, 219, 325
AspS9I	GGNCC	1 cut(s)	310
AsuHPI	GGTGA	4 cut(s)	20, 131, 253, 497
AsuNHI	GCTAGC	1 cut(s)	53
AvaI	CYCGRG	1 cut(s)	516
AvaII	GGWCC	1 cut(s)	310
BaeGI	GKGCMC	1 cut(s)	300
BaeI	ACNNNNGTAYC	1 cut(s)	36
BanI	GGYRCC	1 cut(s)	297
BanII	GRGCYC	1 cut(s)	408
Bbv12I	GWGCWC	1 cut(s)	408
BbvI	GCAGC	4 cut(s)	411, 589, 611, 617
BccI	CCATC	3 cut(s)	34, 209, 433
BcgI	CGANNNNNNTGC	2 cut(s)	643, 677
BciT130I	CCWGG	1 cut(s)	68
BclI	TGATCA	2 cut(s)	258, 478
BfaI	CTAG	4 cut(s)	32, 54, 225, 575
BfmI	CTRYAG	2 cut(s)	594, 603
BfrI	CTTAAG	1 cut(s)	209
BisI	GCNGC	4 cut(s)	400, 600, 603, 606
BlsI	GCNGC	4 cut(s)	401, 601, 604, 607
Bme1390I	CCNGG	1 cut(s)	68
Bme18I	GGWCC	1 cut(s)	310
BmeT110I	CYCGRG	1 cut(s)	516
BmgT120I	GGNCC	1 cut(s)	310
BmiI	GGNNCC	2 cut(s)	299, 312
BmrFI	CCNGG	1 cut(s)	68
BmsI	GCATC	1 cut(s)	169
BmtI	GCTAGC	1 cut(s)	57
BpuEI	CTTGAG	1 cut(s)	153
Bsa29I	ATCGAT	1 cut(s)	105
BsaJI	CCNNGG	1 cut(s)	67
BsaWI	WCCGGW	1 cut(s)	263
BsaXI	ACNNNNNCTCC	2 cut(s)	184, 214
Bsc4I	CCNNNNNNNGG	2 cut(s)	189, 307
Bse3DI	GCAATG	3 cut(s)	26, 64, 129
BseBI	CCWGG	1 cut(s)	68
BseCI	ATCGAT	1 cut(s)	105
BseDI	CCNNGG	1 cut(s)	67
BseGI	GGATG	2 cut(s)	220, 526
BseLI	CCNNNNNNNGG	2 cut(s)	189, 307
BseMI	GCAATG	3 cut(s)	26, 64, 129
BseSI	GKGCMC	1 cut(s)	300
BseXI	GCAGC	4 cut(s)	411, 589, 611, 617
BshNI	GGYRCC	1 cut(s)	297
BshVI	ATCGAT	1 cut(s)	105
BsiHKAI	GWGCWC	1 cut(s)	408
BsiHKCI	CYCGRG	1 cut(s)	516
BsiSI	CCGG	1 cut(s)	264
BslFI	GGGAC	1 cut(s)	296
BslI	CCNNNNNNNGG	2 cut(s)	189, 307
BsmFI	GGGAC	1 cut(s)	296
BsmI	GAATGC	1 cut(s)	296
BsoBI	CYCGRG	1 cut(s)	516
Bsp1286I	GDGCHC	2 cut(s)	300, 408
Bsp143I	GATC	7 cut(s)	109, 258, 347, 433, 452, 478, 610
BspACI	CCGC	2 cut(s)	134, 294
BspDI	ATCGAT	1 cut(s)	105
BspHI	TCATGA	1 cut(s)	282
BspLI	GGNNCC	2 cut(s)	299, 312
BspMAI	CTGCAG	1 cut(s)	607
BspOI	GCTAGC	1 cut(s)	57
BspPI	GGATC	3 cut(s)	104, 355, 605
BspT107I	GGYRCC	1 cut(s)	297
BspTI	CTTAAG	1 cut(s)	209
BsrDI	GCAATG	3 cut(s)	26, 64, 129
BssECI	CCNNGG	1 cut(s)	67
BssMI	GATC	7 cut(s)	109, 258, 347, 433, 452, 478, 610
Bst2UI	CCWGG	1 cut(s)	68
BstAFI	CTTAAG	1 cut(s)	209
BstAPI	GCANNNNNTGC	1 cut(s)	242
BstC8I	GCNNGC	4 cut(s)	55, 296, 397, 404
BstF5I	GGATG	2 cut(s)	220, 526
BstKTI	GATC	7 cut(s)	112, 261, 350, 436, 455, 481, 613
BstMBI	GATC	7 cut(s)	109, 258, 347, 433, 452, 478, 610
BstMWI	GCNNNNNNNGC	4 cut(s)	50, 59, 242, 605
BstNI	CCWGG	1 cut(s)	68
BstNSI	RCATGY	1 cut(s)	636
BstSCI	CCNGG	1 cut(s)	66
BstSFI	CTRYAG	2 cut(s)	594, 603
BstSLI	GKGCMC	1 cut(s)	300
BstV1I	GCAGC	4 cut(s)	411, 589, 611, 617
BstX2I	RGATCY	1 cut(s)	610
BstYI	RGATCY	1 cut(s)	610
Bsu15I	ATCGAT	1 cut(s)	105
BsuTUI	ATCGAT	1 cut(s)	105
BtsCI	GGATG	2 cut(s)	220, 526
Cac8I	GCNNGC	4 cut(s)	55, 296, 397, 404
CaiI	CAGNNNCTG	1 cut(s)	602
CciI	TCATGA	1 cut(s)	282
Cfr13I	GGNCC	1 cut(s)	310
ClaI	ATCGAT	1 cut(s)	105
CviAII	CATG	5 cut(s)	283, 302, 620, 633, 680
DpnI	GATC	7 cut(s)	111, 260, 349, 435, 454, 480, 612
DpnII	GATC	7 cut(s)	109, 258, 347, 433, 452, 478, 610
Ecl136II	GAGCTC	1 cut(s)	406
Eco24I	GRGCYC	1 cut(s)	408
Eco47I	GGWCC	1 cut(s)	310
Eco53kI	GAGCTC	1 cut(s)	406
Eco88I	CYCGRG	1 cut(s)	516
EcoICRI	GAGCTC	1 cut(s)	406
EcoO109I	RGGNCCY	1 cut(s)	310
EcoRI	GAATTC	1 cut(s)	219
EcoRII	CCWGG	1 cut(s)	66
EcoT38I	GRGCYC	1 cut(s)	408
FaeI	CATG	5 cut(s)	286, 305, 623, 636, 683
FalI	AAGNNNNNCTT	2 cut(s)	648, 680
FaqI	GGGAC	1 cut(s)	296
FatI	CATG	5 cut(s)	282, 301, 619, 632, 679
FauI	CCCGC	1 cut(s)	287
FbaI	TGATCA	2 cut(s)	258, 478
Fnu4HI	GCNGC	4 cut(s)	400, 600, 603, 606
FokI	GGATG	2 cut(s)	227, 533
FriOI	GRGCYC	1 cut(s)	408
Fsp4HI	GCNGC	4 cut(s)	400, 600, 603, 606
FspBI	CTAG	4 cut(s)	32, 54, 225, 575
GluI	GCNGC	4 cut(s)	400, 600, 603, 606
HapII	CCGG	1 cut(s)	264
Hin1II	CATG	5 cut(s)	286, 305, 623, 636, 683
HindIII	AAGCTT	1 cut(s)	536
HinfI	GANTC	1 cut(s)	99
HpaII	CCGG	1 cut(s)	264
HphI	GGTGA	4 cut(s)	20, 131, 253, 497
Hpy166II	GTNNAC	1 cut(s)	646
Hpy188I	TCNGA	2 cut(s)	322, 438
Hpy188III	TCNNGA	4 cut(s)	170, 283, 476, 518
Hpy8I	GTNNAC	1 cut(s)	646
HpyAV	CCTTC	1 cut(s)	89
HpyCH4IV	ACGT	1 cut(s)	199
HpyCH4V	TGCA	5 cut(s)	151, 236, 395, 565, 605
HpyF10VI	GCNNNNNNNGC	4 cut(s)	50, 59, 242, 605
HpySE526I	ACGT	1 cut(s)	199
Hsp92II	CATG	5 cut(s)	286, 305, 623, 636, 683
Ksp22I	TGATCA	2 cut(s)	258, 478
Kzo9I	GATC	7 cut(s)	109, 258, 347, 433, 452, 478, 610
LpnPI	CCDG	8 cut(s)	53, 80, 231, 277, 293, 327, 467, 628
Lsp1109I	GCAGC	4 cut(s)	411, 589, 611, 617
LweI	GCATC	1 cut(s)	169
MaeI	CTAG	4 cut(s)	32, 54, 225, 575
MaeII	ACGT	1 cut(s)	199
MaeIII	GTNAC	2 cut(s)	200, 485
MalI	GATC	7 cut(s)	111, 260, 349, 435, 454, 480, 612
MboI	GATC	7 cut(s)	109, 258, 347, 433, 452, 478, 610
MboII	GAAGA	2 cut(s)	461, 464
MflI	RGATCY	1 cut(s)	610
MhlI	GDGCHC	2 cut(s)	300, 408
MluCI	AATT	5 cut(s)	122, 219, 252, 325, 332
MlyI	GAGTC	1 cut(s)	108
MnlI	CCTC	4 cut(s)	75, 173, 186, 616
MseI	TTAA	3 cut(s)	210, 410, 629
MslI	CAYNNNNRTG	1 cut(s)	551
MspA1I	CMGCKG	1 cut(s)	602
MspCI	CTTAAG	1 cut(s)	209
MspI	CCGG	1 cut(s)	264
MspR9I	CCNGG	1 cut(s)	68
Mva1269I	GAATGC	1 cut(s)	296
MvaI	CCWGG	1 cut(s)	68
MwoI	GCNNNNNNNGC	4 cut(s)	50, 59, 242, 605
NdeII	GATC	7 cut(s)	109, 258, 347, 433, 452, 478, 610
NheI	GCTAGC	1 cut(s)	53
NlaIII	CATG	5 cut(s)	286, 305, 623, 636, 683
NlaIV	GGNNCC	2 cut(s)	299, 312
NmuCI	GTSAC	1 cut(s)	485
NspI	RCATGY	1 cut(s)	636
PagI	TCATGA	1 cut(s)	282
PciI	ACATGT	1 cut(s)	632
PctI	GAATGC	1 cut(s)	296
PflMI	CCANNNNNTGG	1 cut(s)	189
PkrI	GCNGC	4 cut(s)	401, 601, 604, 607
PleI	GAGTC	1 cut(s)	107
PpsI	GAGTC	1 cut(s)	107
PpuMI	RGGWCCY	1 cut(s)	310
PscI	ACATGT	1 cut(s)	632
Psp124BI	GAGCTC	1 cut(s)	408
Psp1406I	AACGTT	1 cut(s)	199
Psp5II	RGGWCCY	1 cut(s)	310
Psp6I	CCWGG	1 cut(s)	66
PspGI	CCWGG	1 cut(s)	66
PspN4I	GGNNCC	2 cut(s)	299, 312
PspPI	GGNCC	1 cut(s)	310
PspPPI	RGGWCCY	1 cut(s)	310
PstI	CTGCAG	1 cut(s)	607
PstNI	CAGNNNCTG	1 cut(s)	602
PsuI	RGATCY	1 cut(s)	610
PvuII	CAGCTG	1 cut(s)	602
RseI	CAYNNNNRTG	1 cut(s)	551
SacI	GAGCTC	1 cut(s)	408
SaqAI	TTAA	3 cut(s)	210, 410, 629
SatI	GCNGC	4 cut(s)	400, 600, 603, 606
Sau3AI	GATC	7 cut(s)	109, 258, 347, 433, 452, 478, 610
Sau96I	GGNCC	1 cut(s)	310
SchI	GAGTC	1 cut(s)	108
ScrFI	CCNGG	1 cut(s)	68
SduI	GDGCHC	2 cut(s)	300, 408
SfaNI	GCATC	1 cut(s)	169
SfcI	CTRYAG	2 cut(s)	594, 603
SinI	GGWCC	1 cut(s)	310
SmiMI	CAYNNNNRTG	1 cut(s)	551
SmlI	CTYRAG	2 cut(s)	168, 209
SmoI	CTYRAG	2 cut(s)	168, 209
Sse9I	AATT	5 cut(s)	122, 219, 252, 325, 332
SsiI	CCGC	2 cut(s)	134, 294
SspI	AATATT	1 cut(s)	241
SspMI	CTAG	4 cut(s)	32, 54, 225, 575
SstI	GAGCTC	1 cut(s)	408
StyD4I	CCNGG	1 cut(s)	66
TaiI	ACGT	1 cut(s)	202
TaqI	TCGA	3 cut(s)	105, 366, 653
TasI	AATT	5 cut(s)	122, 219, 252, 325, 332
Tru1I	TTAA	3 cut(s)	210, 410, 629
Tru9I	TTAA	3 cut(s)	210, 410, 629
TseFI	GTSAC	1 cut(s)	485
TseI	GCWGC	4 cut(s)	399, 599, 602, 605
Tsp45I	GTSAC	1 cut(s)	485
TspDTI	ATGAA	4 cut(s)	108, 118, 488, 545
Van91I	CCANNNNNTGG	1 cut(s)	189
Vha464I	CTTAAG	1 cut(s)	209
VpaK11BI	GGWCC	1 cut(s)	310
XapI	RAATTY	3 cut(s)	122, 219, 325
XceI	RCATGY	1 cut(s)	636
XspI	CTAG	4 cut(s)	32, 54, 225, 575

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.