RchiOBHm_Chr2g0104271

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
15665440 .. 15665814
375 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 375 bp
ATGTGTAGCATCAGTCAAGCTTTCAGCAACTCTTCCTTCCAAATTTCATTTGCATTTCCAAATGTAGAGGAATTGAACATTGACTATTGCAGTGACTTGGTGGAATTATGTGGTGATCTCAGTGATCTGATTGAGCTAAAGAATCTCAGTATCACCCACTGTCACAAGCTATCTGCCTTGCCTGAAGAGATAGGAAATTTGATCAAATTGGAAGTCTTGAGGCTAAAGTCATGTTCAGACTTGGTAACATTTCCAACCTCAATTAAGAACCTCGGAAAGTTGCAGTTTCTCGACATATCAGATTGCTTCAGCATCAAGGAGTTGCCTGAAGACATTGGTGAAATCAGCACTTTAAAAAAGATCAATATGAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

13.87

Weight (kDa)

4.7

Isoelectric Point (pI)

40.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 18 - 122 2.6e-12 Leucine-rich repeat region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 42, 196
AcuI CTGAAG 3 cut(s) 204, 292, 348
AgsI TTSAA 1 cut(s) 76
AluBI AGCT 3 cut(s) 20, 136, 169
AluI AGCT 3 cut(s) 20, 136, 169
ApoI RAATTY 2 cut(s) 42, 196
ArsI GACNNNNNNTTYG 2 cut(s) 198, 230
AsuHPI GGTGA 3 cut(s) 125, 145, 350
BbsI GAAGAC 1 cut(s) 336
BclI TGATCA 1 cut(s) 201
BmsI GCATC 2 cut(s) 18, 321
BpiI GAAGAC 1 cut(s) 336
BpuEI CTTGAG 1 cut(s) 238
BsaJI CCNNGG 1 cut(s) 271
BseDI CCNNGG 1 cut(s) 271
BseMII CTCAG 2 cut(s) 133, 160
Bsp143I GATC 4 cut(s) 115, 124, 201, 360
BspCNI CTCAG 2 cut(s) 132, 159
BssECI CCNNGG 1 cut(s) 271
BssMI GATC 4 cut(s) 115, 124, 201, 360
Bst4CI ACNGT 1 cut(s) 161
Bst6I CTCTTC 2 cut(s) 37, 180
BstDEI CTNAG 2 cut(s) 119, 146
BstKTI GATC 4 cut(s) 118, 127, 204, 363
BstMBI GATC 4 cut(s) 115, 124, 201, 360
BstV2I GAAGAC 1 cut(s) 336
BtsI GCAGTG 1 cut(s) 97
BtsIMutI CAGTG 3 cut(s) 97, 127, 157
CviAII CATG 1 cut(s) 231
CviJI RGCY 4 cut(s) 20, 136, 169, 223
CviKI_1 RGCY 4 cut(s) 20, 136, 169, 223
DdeI CTNAG 2 cut(s) 119, 146
DpnI GATC 4 cut(s) 117, 126, 203, 362
DpnII GATC 4 cut(s) 115, 124, 201, 360
DraI TTTAAA 1 cut(s) 354
Eam1104I CTCTTC 2 cut(s) 37, 180
EarI CTCTTC 2 cut(s) 37, 180
Eco57I CTGAAG 3 cut(s) 204, 292, 348
FaeI CATG 1 cut(s) 234
FaiI YATR 4 cut(s) 109, 232, 296, 368
FatI CATG 1 cut(s) 230
FbaI TGATCA 1 cut(s) 201
Hin1II CATG 1 cut(s) 234
HindIII AAGCTT 1 cut(s) 18
HinfI GANTC 1 cut(s) 142
HphI GGTGA 3 cut(s) 125, 145, 350
Hpy188I TCNGA 4 cut(s) 129, 238, 275, 301
Hpy188III TCNNGA 2 cut(s) 217, 290
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 1 cut(s) 161
HpyCH4V TGCA 3 cut(s) 53, 90, 283
HpyF3I CTNAG 2 cut(s) 119, 146
Hsp92II CATG 1 cut(s) 234
Ksp22I TGATCA 1 cut(s) 201
Kzo9I GATC 4 cut(s) 115, 124, 201, 360
LpnPI CCDG 2 cut(s) 195, 339
LweI GCATC 2 cut(s) 18, 321
MaeIII GTNAC 3 cut(s) 92, 161, 244
MalI GATC 4 cut(s) 117, 126, 203, 362
MboI GATC 4 cut(s) 115, 124, 201, 360
MboII GAAGA 3 cut(s) 24, 197, 341
MluCI AATT 6 cut(s) 42, 71, 104, 196, 206, 261
MmeI TCCRAC 1 cut(s) 278
MnlI CCTC 4 cut(s) 61, 213, 268, 281
MseI TTAA 2 cut(s) 264, 353
NdeII GATC 4 cut(s) 115, 124, 201, 360
NlaIII CATG 1 cut(s) 234
NmuCI GTSAC 2 cut(s) 92, 161
PfeI GAWTC 1 cut(s) 142
SaqAI TTAA 2 cut(s) 264, 353
Sau3AI GATC 4 cut(s) 115, 124, 201, 360
SetI ASST 5 cut(s) 22, 138, 171, 260, 273
SfaNI GCATC 2 cut(s) 18, 321
SmlI CTYRAG 1 cut(s) 217
SmoI CTYRAG 1 cut(s) 217
Sse9I AATT 6 cut(s) 42, 71, 104, 196, 206, 261
TaaI ACNGT 1 cut(s) 161
TaqI TCGA 1 cut(s) 291
TasI AATT 6 cut(s) 42, 71, 104, 196, 206, 261
TfiI GAWTC 1 cut(s) 142
Tru1I TTAA 2 cut(s) 264, 353
Tru9I TTAA 2 cut(s) 264, 353
TscAI CASTG 3 cut(s) 97, 127, 164
TseFI GTSAC 2 cut(s) 92, 161
Tsp45I GTSAC 2 cut(s) 92, 161
TspDTI ATGAA 1 cut(s) 36
TspRI CASTG 3 cut(s) 97, 127, 164
XapI RAATTY 2 cut(s) 42, 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.