RchiOBHm_Chr2g0104321

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
15720453 .. 15720980
528 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 528 bp
ATGTGTAGCATCAGTCAAGCTTTCAGCAACTCTTCCTTCCAAATTTCATATGCATTTCCAAATTTAGAGGAACTGAACATTGACAGTGACTTGGTGGAATTGTCTGGTGATCTCAGTGATCTGATTGAGCTAAAGAAGCTCAGTATCACCCACTGTCACAAGCTATCTGCCTTGCCTGAAGTGATAGGAAATTTGATCAAATTGGAAGTCTTGAGGCTAAAGTCATGTTCAGACTTGGTAACATTTCCAGCCTCAATTAAGAACCTCGGAAAGTTGCAGTTTCTCGACATATCTGATTGCTTCAGCATCAAGGAGTTGCCTGAAGACATTGGTGAAATCAGCACTTTAAAAAAGATCAATATGAGACAGTGCTCTAGACTGCAAGATCTACCTGATTCAGTTTATGATCTCGAGCAACTAGAGGAAGTGATATTTGATGAGAAAACAAGAGACTTGTGGGAGCTTTTCCGGCTCAAAATAGAGATTAGGGTCCTCAAAGACGAATTCAACCTGGATTGGCTCTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

175

Amino Acids

20.13

Weight (kDa)

4.6

Isoelectric Point (pI)

47.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 36 - 99 2.5e-07 Leucine-rich repeat region
LRR_13 PF23286 66 - 139 1.7e-06 Disease resistance protein RPS4B-like, leucine-rich repeats
LRR_14 PF23598 85 - 150 2.3e-08 Leucine-rich repeat region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 4 cut(s) 42, 61, 190, 503
AcuI CTGAAG 3 cut(s) 198, 286, 342
AgsI TTSAA 1 cut(s) 508
AjnI CCWGG 1 cut(s) 510
AluBI AGCT 5 cut(s) 20, 130, 139, 163, 463
AluI AGCT 5 cut(s) 20, 130, 139, 163, 463
Alw21I GWGCWC 1 cut(s) 374
Alw26I GTCTC 2 cut(s) 358, 444
Ama87I CYCGRG 1 cut(s) 410
ApoI RAATTY 4 cut(s) 42, 61, 190, 503
ArsI GACNNNNNNTTYG 2 cut(s) 192, 224
AspS9I GGNCC 1 cut(s) 490
AsuHPI GGTGA 3 cut(s) 119, 139, 344
AvaI CYCGRG 1 cut(s) 410
AvaII GGWCC 1 cut(s) 490
BbsI GAAGAC 1 cut(s) 330
Bbv12I GWGCWC 1 cut(s) 374
BciT130I CCWGG 1 cut(s) 512
BclI TGATCA 1 cut(s) 195
BcoDI GTCTC 2 cut(s) 358, 444
BfaI CTAG 2 cut(s) 375, 419
BglII AGATCT 1 cut(s) 385
Bme1390I CCNGG 1 cut(s) 512
Bme18I GGWCC 1 cut(s) 490
BmeT110I CYCGRG 1 cut(s) 410
BmgT120I GGNCC 1 cut(s) 490
BmiI GGNNCC 1 cut(s) 491
BmrFI CCNGG 1 cut(s) 512
BmsI GCATC 2 cut(s) 18, 315
BpiI GAAGAC 1 cut(s) 330
BpuEI CTTGAG 1 cut(s) 232
BsaJI CCNNGG 1 cut(s) 265
BseBI CCWGG 1 cut(s) 512
BseDI CCNNGG 1 cut(s) 265
BseMII CTCAG 2 cut(s) 127, 154
BsiHKAI GWGCWC 1 cut(s) 374
BsiHKCI CYCGRG 1 cut(s) 410
BsiSI CCGG 1 cut(s) 469
BsmAI GTCTC 2 cut(s) 358, 444
BsoBI CYCGRG 1 cut(s) 410
Bsp1286I GDGCHC 1 cut(s) 374
Bsp143I GATC 6 cut(s) 109, 118, 195, 354, 385, 406
BspCNI CTCAG 2 cut(s) 126, 153
BspLI GGNNCC 1 cut(s) 491
BssECI CCNNGG 1 cut(s) 265
BssMI GATC 6 cut(s) 109, 118, 195, 354, 385, 406
Bst2UI CCWGG 1 cut(s) 512
Bst4CI ACNGT 3 cut(s) 86, 155, 369
Bst6I CTCTTC 1 cut(s) 37
BstDEI CTNAG 2 cut(s) 113, 140
BstKTI GATC 6 cut(s) 112, 121, 198, 357, 388, 409
BstMAI GTCTC 2 cut(s) 358, 444
BstMBI GATC 6 cut(s) 109, 118, 195, 354, 385, 406
BstMWI GCNNNNNNNGC 2 cut(s) 136, 469
BstNI CCWGG 1 cut(s) 512
BstSCI CCNGG 1 cut(s) 510
BstV2I GAAGAC 1 cut(s) 330
BstX2I RGATCY 1 cut(s) 385
BstYI RGATCY 1 cut(s) 385
BtsIMutI CAGTG 4 cut(s) 91, 121, 151, 374
Cfr13I GGNCC 1 cut(s) 490
CviAII CATG 1 cut(s) 225
CviJI RGCY 9 cut(s) 20, 130, 139, 163, 217, 251, 463, 472, 520
CviKI_1 RGCY 9 cut(s) 20, 130, 139, 163, 217, 251, 463, 472, 520
DdeI CTNAG 2 cut(s) 113, 140
DpnI GATC 6 cut(s) 111, 120, 197, 356, 387, 408
DpnII GATC 6 cut(s) 109, 118, 195, 354, 385, 406
DraI TTTAAA 1 cut(s) 348
Eam1104I CTCTTC 1 cut(s) 37
EarI CTCTTC 1 cut(s) 37
Eco47I GGWCC 1 cut(s) 490
Eco57I CTGAAG 3 cut(s) 198, 286, 342
Eco88I CYCGRG 1 cut(s) 410
EcoO109I RGGNCCY 1 cut(s) 490
EcoRI GAATTC 1 cut(s) 503
EcoRII CCWGG 1 cut(s) 510
EcoT22I ATGCAT 1 cut(s) 55
FaeI CATG 1 cut(s) 228
FaiI YATR 6 cut(s) 49, 51, 226, 290, 362, 405
FatI CATG 1 cut(s) 224
FauNDI CATATG 1 cut(s) 49
FbaI TGATCA 1 cut(s) 195
FspBI CTAG 2 cut(s) 375, 419
HapII CCGG 1 cut(s) 469
Hin1II CATG 1 cut(s) 228
HindIII AAGCTT 1 cut(s) 18
HinfI GANTC 1 cut(s) 395
HpaII CCGG 1 cut(s) 469
HphI GGTGA 3 cut(s) 119, 139, 344
Hpy188I TCNGA 4 cut(s) 123, 232, 269, 295
Hpy188III TCNNGA 4 cut(s) 211, 284, 375, 410
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 3 cut(s) 86, 155, 369
HpyCH4V TGCA 3 cut(s) 53, 277, 382
HpyF10VI GCNNNNNNNGC 2 cut(s) 136, 469
HpyF3I CTNAG 2 cut(s) 113, 140
Hsp92II CATG 1 cut(s) 228
Ksp22I TGATCA 1 cut(s) 195
Kzo9I GATC 6 cut(s) 109, 118, 195, 354, 385, 406
LmnI GCTCC 1 cut(s) 460
LpnPI CCDG 8 cut(s) 90, 189, 261, 333, 405, 482, 497, 524
LweI GCATC 2 cut(s) 18, 315
MaeI CTAG 2 cut(s) 375, 419
MaeIII GTNAC 3 cut(s) 86, 155, 238
MalI GATC 6 cut(s) 111, 120, 197, 356, 387, 408
MboI GATC 6 cut(s) 109, 118, 195, 354, 385, 406
MboII GAAGA 2 cut(s) 24, 335
MflI RGATCY 1 cut(s) 385
MhlI GDGCHC 1 cut(s) 374
MluCI AATT 7 cut(s) 42, 61, 98, 190, 200, 255, 503
MnlI CCTC 6 cut(s) 61, 207, 262, 275, 415, 503
Mph1103I ATGCAT 1 cut(s) 55
MseI TTAA 2 cut(s) 258, 347
MspI CCGG 1 cut(s) 469
MspR9I CCNGG 1 cut(s) 512
MvaI CCWGG 1 cut(s) 512
MwoI GCNNNNNNNGC 2 cut(s) 136, 469
NdeI CATATG 1 cut(s) 49
NdeII GATC 6 cut(s) 109, 118, 195, 354, 385, 406
NlaIII CATG 1 cut(s) 228
NlaIV GGNNCC 1 cut(s) 491
NmuCI GTSAC 2 cut(s) 86, 155
NsiI ATGCAT 1 cut(s) 55
PaeR7I CTCGAG 1 cut(s) 410
PfeI GAWTC 1 cut(s) 395
PpuMI RGGWCCY 1 cut(s) 490
Psp5II RGGWCCY 1 cut(s) 490
Psp6I CCWGG 1 cut(s) 510
PspGI CCWGG 1 cut(s) 510
PspN4I GGNNCC 1 cut(s) 491
PspPI GGNCC 1 cut(s) 490
PspPPI RGGWCCY 1 cut(s) 490
PsuI RGATCY 1 cut(s) 385
SaqAI TTAA 2 cut(s) 258, 347
Sau3AI GATC 6 cut(s) 109, 118, 195, 354, 385, 406
Sau96I GGNCC 1 cut(s) 490
ScrFI CCNGG 1 cut(s) 512
SduI GDGCHC 1 cut(s) 374
SetI ASST 8 cut(s) 22, 132, 141, 165, 267, 394, 465, 513
SfaNI GCATC 2 cut(s) 18, 315
Sfr274I CTCGAG 1 cut(s) 410
SinI GGWCC 1 cut(s) 490
SlaI CTCGAG 1 cut(s) 410
SmlI CTYRAG 2 cut(s) 211, 410
SmoI CTYRAG 2 cut(s) 211, 410
Sse9I AATT 7 cut(s) 42, 61, 98, 190, 200, 255, 503
SspMI CTAG 2 cut(s) 375, 419
StyD4I CCNGG 1 cut(s) 510
TaaI ACNGT 3 cut(s) 86, 155, 369
TaqI TCGA 2 cut(s) 285, 411
TasI AATT 7 cut(s) 42, 61, 98, 190, 200, 255, 503
TfiI GAWTC 1 cut(s) 395
Tru1I TTAA 2 cut(s) 258, 347
Tru9I TTAA 2 cut(s) 258, 347
TscAI CASTG 4 cut(s) 91, 121, 158, 374
TseFI GTSAC 2 cut(s) 86, 155
Tsp45I GTSAC 2 cut(s) 86, 155
TspDTI ATGAA 1 cut(s) 36
TspRI CASTG 4 cut(s) 91, 121, 158, 374
VpaK11BI GGWCC 1 cut(s) 490
XapI RAATTY 4 cut(s) 42, 61, 190, 503
XbaI TCTAGA 1 cut(s) 374
XhoI CTCGAG 1 cut(s) 410
XspI CTAG 2 cut(s) 375, 419
Zsp2I ATGCAT 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.