RchiOBHm_Chr1g0327621

Belongs to the DOCK family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
16566815 .. 16570346
3532 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGCTACAATTTGCTTATATAATAGGTAGAGGAGAAAAGTTGTCGGAGGATTTCTATTTTCGTCACGCACCAACAGAAACACAGAATCTAAGAACTTTATATATTTTTGCCACCACTTTAATGGTCATCCTTTGTTCTTTAAGTAAATTTTTAGCACACATCATGACTGACAAATTTACTACTGCCTTTTTTTGGGTGAAGATTTCTTTTGAACCCCGTGGAATCTTCTAG

Protein Analysis

76

Amino Acids

8.96

Weight (kDa)

8.93

Isoelectric Point (pI)

29.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 146, 173
AfiI CCNNNNNNNGG 1 cut(s) 192
AgsI TTSAA 1 cut(s) 212
ApoI RAATTY 2 cut(s) 146, 173
AsuHPI GGTGA 1 cut(s) 208
BfaI CTAG 1 cut(s) 229
BsaJI CCNNGG 1 cut(s) 217
Bsc4I CCNNNNNNNGG 1 cut(s) 192
BseDI CCNNGG 1 cut(s) 217
BseGI GGATG 1 cut(s) 126
BseLI CCNNNNNNNGG 1 cut(s) 192
BseRI GAGGAG 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 192
BspHI TCATGA 1 cut(s) 162
BssECI CCNNGG 1 cut(s) 217
BstDEI CTNAG 1 cut(s) 89
BstDSI CCRYGG 1 cut(s) 217
BstF5I GGATG 1 cut(s) 126
BstXI CCANNNNNNTGG 1 cut(s) 121
BtgI CCRYGG 1 cut(s) 217
BtsCI GGATG 1 cut(s) 126
CciI TCATGA 1 cut(s) 162
CviAII CATG 1 cut(s) 163
DdeI CTNAG 1 cut(s) 89
FaeI CATG 1 cut(s) 166
FaiI YATR 5 cut(s) 18, 20, 100, 102, 164
FatI CATG 1 cut(s) 162
FokI GGATG 1 cut(s) 113
FspBI CTAG 1 cut(s) 229
Hin1II CATG 1 cut(s) 166
HinfI GANTC 2 cut(s) 85, 222
HphI GGTGA 1 cut(s) 208
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 1 cut(s) 163
HpyF3I CTNAG 1 cut(s) 89
Hsp92II CATG 1 cut(s) 166
MaeI CTAG 1 cut(s) 229
MaeIII GTNAC 1 cut(s) 62
MboII GAAGA 2 cut(s) 211, 217
MluCI AATT 3 cut(s) 8, 146, 173
MmeI TCCRAC 1 cut(s) 24
MnlI CCTC 2 cut(s) 23, 40
MseI TTAA 2 cut(s) 119, 140
MslI CAYNNNNRTG 1 cut(s) 119
NlaIII CATG 1 cut(s) 166
NmuCI GTSAC 1 cut(s) 62
PagI TCATGA 1 cut(s) 162
PfeI GAWTC 2 cut(s) 85, 222
RseI CAYNNNNRTG 1 cut(s) 119
SaqAI TTAA 2 cut(s) 119, 140
SetI ASST 1 cut(s) 28
SgeI CNNG 2 cut(s) 77, 175
SmiMI CAYNNNNRTG 1 cut(s) 119
Sse9I AATT 3 cut(s) 8, 146, 173
SspMI CTAG 1 cut(s) 229
TasI AATT 3 cut(s) 8, 146, 173
TfiI GAWTC 2 cut(s) 85, 222
Tru1I TTAA 2 cut(s) 119, 140
Tru9I TTAA 2 cut(s) 119, 140
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
XapI RAATTY 2 cut(s) 146, 173
XcmI CCANNNNNNNNNTGG 1 cut(s) 118
XspI CTAG 1 cut(s) 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.